Login to display prices
Login to display prices
NDUFA10-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa Gene View larger

NDUFA10-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa Gene

PTXBC003417

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA10-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA10-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa Gene

Proteogenix catalog: PTXBC003417
Ncbi symbol: NDUFA10
Product name: NDUFA10-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa Gene
Size: 2ug
Accessions: BC003417
Gene id: 4705
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Synonyms: CI-42KD; CI-42k; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial; NADH-ubiquinone oxidoreductase 42 kDa subunit; complex I 42kDa subunit; NADH:ubiquinone oxidoreductase subunit A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttgcggctcctgaagctggcagcgacgtccgcgtccgcccgggtcgtggcggcgggcgcccagcgcgtgagaggaattcatagcagtgtgcagtgcaagctgcgctatggaatgtggcatttcctacttggggataaagcaagcaaaagactgacagaacgcagcagagtgataactgtagatggcaatatatgtactggaaaaggcaaacttgcaaaagaaatagcagagaaactaggcttcaagcactttcctgaagcggggattcattatccagacagtaccacaggagatgggaagcccctcgccaccgactataatggcaactgtagtttggagaaattttacgatgatccgagaagcaatgatggcaacagttaccgcctgcagtcctggttgtacagcagtcgcctgctgcagtactcagatgccttggagcacttgctgaccacaggacaaggtgttgtgttggagcgctccatcttcagtgactttgtgttcctggaggcgatgtacaaccagggattcatccgaaagcagtgtgtggaccactacaacgaggtgaagagcgtcaccatctgcgattacctgcccccccacctggtgatttacatcgatgtgcccgttccagaggtccagaggcggattcagaagaaaggagatccacatgaaatgaagatcacctctgcctatctacaggacattgagaatgcctataagaaaacctttctccctgagatgagtgaaaaatgtgaggttttacagtattctgcaagggaagctcaagattcaaaaaaggtggtagaggacattgaatacctgaagttcgataaagggccgtggctcaagcaggacaatcgcactttataccacctgcgattactggttcaggataagtttgaggtgctgaattacacaagcattcctatctttctcccggaagtcaccattggagctcatcagactgaccgtgtcttacatcagttcagagagctgccgggccgcaagtacagccctgggtacaacaccgaggtgggagacaagtggatctggctgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: