HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene View larger

HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene


New product

Data sheet of HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014485
Product type: DNA & cDNA
Ncbi symbol: HSP90AB1
Origin species: Human
Product name: HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene
Size: 2ug
Accessions: BC014485
Gene id: 3326
Gene description: heat shock protein 90kDa alpha (cytosolic), class B member 1
Synonyms: D6S182; HSP84; HSP90B; HSPC2; HSPCB; heat shock protein HSP 90-beta; HSP90-beta; heat shock 84 kDa; heat shock 90kD protein 1, beta; heat shock protein 90 kDa; heat shock protein 90kDa alpha (cytosolic), class B member 1; heat shock protein 90kDa alpha family class B member 1; heat shock protein 90 alpha family class B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgaggaagtgcaccatggagaggaggaggtggagacttttgcctttcaggcagaaattgcccaactcatgtccctcatcatcaataccttctattccaacaaggagattttccttcgggagttgatctctaatgcttctgatgccttggacaagattcgctatgagagcctgacagacccttcgaagttggacagtggtaaagagctgaaaattgacatcatccccaaccctcaggaacgtaccctgactttggtagacacaggcattggcatgaccaaagctgatctcataaataatttgggaaccattgccaagtctggtactaaagcattcatggaggctcttcaggctggtgcagacatctccatgattgggcagtttggtgttggcttttattctgcctacttggtggcagagaaagtggttgtgatcacaaagcacaacgatgatgaacagtatgcttgggagtcttctgctggaggttccttcactgtgcgtgctgaccatggtgagcccattggcaggggtaccaaagtgatcctccatcttaaagaagatcagacagagtacctagaagagaggcgggtcaaagaagtagtgaagaagcattctcagttcataggctatcccatcaccctttatttggagaaggaacgagagaaggaaattagtgatgatgaggcagaggaagagaaaggtgagaaagaagaggaagataaagatgatgaagaaaagcccaagatcgaagatgtgggttcagatgaggaggatgacagcggtaaggataagaagaagaaaactaagaagatcaaagagaaatacattgatcaggaagaactaaacaagaccaagcctatttggaccagaaaccctgatgacatcacccaagaggagtatggagaattctacaagagcctcactaatgactgggaagaccacttggcagtcaagcacttttctgtagaaggtcagttggaattcagggcattgctatttattcctcgtcgggctccctttgacctttttgagaacaagaagaaaaagaacaacatcaaactctatgtccgccgtgtgttcatcatggacagctgtgatgagttgataccagagtatctcaattttatccgtggtgtggttgactctgaggatctgcccctgaacatctcccgagaaatgctccagcagagcaaaatcttgaaagtcattcgcaaaaacattgttaagaagtgccttgagctcttctctgagctggcagaagacaaggagaattacaagaaattctatgaggcattctctaaaaatctcaagcttggaatccacgaagactccactaaccgccgccgcctgtctgagctgctgcgctatcatacctcccagtctggagatgagatgacatctctgtcagagtatgtttctcgcatgaaggagacacagaagtccatctattacatcactggtgagagcaaagagcaggtggccaactcagcttttgtggagcgagtgcggaaacggggcttcgaggtggtatatatgaccgagcccattgacgagtactgtgtgcagcagctcaaggaatttgatgggaagagcctggtctcagttaccaaggagggtctggagctgcctgaggatgaggaggagaagaagaagatggaagagagcaaggcaaagtttgagaacctctgcaagctcatgaaagaaatcttagataagaaggttgagaaggtgacaatctccaatagacttgtgtcttcaccttgctgcattgtgaccagcacctacggctggacagccaatatggagcggatcatgaaagcccaggcacttcgggacaactccaccatgggctatatgatggccaaaaagcacctggagatcaaccctgaccaccccattgtggagacgctgcggcagaaggctgaggccgacaagaatgataaggcagttaaggacctggtggtgctgctgtttgaaaccgccctgctatcttctggcttttcccttgaggatccccagacccactccaaccgcatctatcgcatgatcaagctaggtctaggtattgatgaagatgaagtggcagcagaggaacccaatgctgcagttcctgatgagatcccccctctcgagggcgatgaggatgcgtctcgcatggaagaagtcgattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa
- translocase of inner mitochondrial membrane 22 homolog (yeast)
- polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like

Buy HSP90AB1-heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene now

Add to cart