DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene View larger

DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000346
Product type: DNA & cDNA
Ncbi symbol: DUSP11
Origin species: Human
Product name: DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene
Size: 2ug
Accessions: BC000346
Gene id: 8446
Gene description: dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Synonyms: RNA/RNP complex-1-interacting phosphatase; RNA/RNP complex 1-interacting; RNA/RNP complex-interacting phosphatase; dual specificity protein phosphatase 11; phosphatase that interacts with RNA/RNP complex 1; serine/threonine specific protein phosphatase; dual specificity phosphatase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccagtggcatcatccccgcagtggctggggccggagacgcgacttttcaggacgctcctcagccaagaagaagggcggaaaccacatccccgaaaggtggaaagactatctcccagttggacagcggatgcctgggactcgtttcattgctttcaaagttcctttgcaaaagagttttgaaaagaaacttgctccagaagaatgcttttcccctttggatctttttaacaaaatccgagaacaaaatgaagaacttggactgattattgatttaacatatactcaacgctattataaaccagaggatttgccagaaactgttccttacttaaaaatttttacagttggacatcaagtgcctgatgatgagactatttttaaattcaaacacgctgttaatgggtttttgaaagaaaataaagataatgataaacttattggtgtccactgtacccatggtttaaacaggactggctacctcatttgcatatatttgattgatgtagaaggcgtgaggccagatgatgcaattgaattattcaataggtgccggggacattgcttagaaagacaaaactacattgaagaccttcagaatggtcctatcagaaagaattggaattccagtgtacccaggtcaagtgattttgaagactcagcacatctcatgcaaccagtccacaataagcctgttaaacaaggacctaggtataatctacatcagatccagggtcactcagctcctcgacatttccacacccagacccaaagtttgcaacaatcagtcagaaaattttcagagaatccacatgtttaccagagacaccatctccctcctcctggtccccctggagaggactattcacacaggaggtattcttggaatgtgaagcccaatgccagtcgggcagcccaggatagaagaaggtggtatccttataattactccagactctcctatccagcctgttgggaatggacccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)
- defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
- dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4
- solute carrier family 22 (organic anion transporter), member 6

Buy DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene now

Add to cart