Login to display prices
Login to display prices
DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene View larger

DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene

PTXBC000346

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene

Proteogenix catalog: PTXBC000346
Ncbi symbol: DUSP11
Product name: DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene
Size: 2ug
Accessions: BC000346
Gene id: 8446
Gene description: dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
Synonyms: RNA/RNP complex-1-interacting phosphatase; RNA/RNP complex 1-interacting; RNA/RNP complex-interacting phosphatase; dual specificity protein phosphatase 11; phosphatase that interacts with RNA/RNP complex 1; serine/threonine specific protein phosphatase; dual specificity phosphatase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccagtggcatcatccccgcagtggctggggccggagacgcgacttttcaggacgctcctcagccaagaagaagggcggaaaccacatccccgaaaggtggaaagactatctcccagttggacagcggatgcctgggactcgtttcattgctttcaaagttcctttgcaaaagagttttgaaaagaaacttgctccagaagaatgcttttcccctttggatctttttaacaaaatccgagaacaaaatgaagaacttggactgattattgatttaacatatactcaacgctattataaaccagaggatttgccagaaactgttccttacttaaaaatttttacagttggacatcaagtgcctgatgatgagactatttttaaattcaaacacgctgttaatgggtttttgaaagaaaataaagataatgataaacttattggtgtccactgtacccatggtttaaacaggactggctacctcatttgcatatatttgattgatgtagaaggcgtgaggccagatgatgcaattgaattattcaataggtgccggggacattgcttagaaagacaaaactacattgaagaccttcagaatggtcctatcagaaagaattggaattccagtgtacccaggtcaagtgattttgaagactcagcacatctcatgcaaccagtccacaataagcctgttaaacaaggacctaggtataatctacatcagatccagggtcactcagctcctcgacatttccacacccagacccaaagtttgcaacaatcagtcagaaaattttcagagaatccacatgtttaccagagacaccatctccctcctcctggtccccctggagaggactattcacacaggaggtattcttggaatgtgaagcccaatgccagtcgggcagcccaggatagaagaaggtggtatccttataattactccagactctcctatccagcctgttgggaatggacccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: