Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene
PTXBC000346
New product
Data sheet of DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000346 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP11 |
| Origin species: | Human |
| Product name: | DUSP11-dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) Gene |
| Size: | 2ug |
| Accessions: | BC000346 |
| Gene id: | 8446 |
| Gene description: | dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) |
| Synonyms: | RNA/RNP complex-1-interacting phosphatase; RNA/RNP complex 1-interacting; RNA/RNP complex-interacting phosphatase; dual specificity protein phosphatase 11; phosphatase that interacts with RNA/RNP complex 1; serine/threonine specific protein phosphatase; dual specificity phosphatase 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccagtggcatcatccccgcagtggctggggccggagacgcgacttttcaggacgctcctcagccaagaagaagggcggaaaccacatccccgaaaggtggaaagactatctcccagttggacagcggatgcctgggactcgtttcattgctttcaaagttcctttgcaaaagagttttgaaaagaaacttgctccagaagaatgcttttcccctttggatctttttaacaaaatccgagaacaaaatgaagaacttggactgattattgatttaacatatactcaacgctattataaaccagaggatttgccagaaactgttccttacttaaaaatttttacagttggacatcaagtgcctgatgatgagactatttttaaattcaaacacgctgttaatgggtttttgaaagaaaataaagataatgataaacttattggtgtccactgtacccatggtttaaacaggactggctacctcatttgcatatatttgattgatgtagaaggcgtgaggccagatgatgcaattgaattattcaataggtgccggggacattgcttagaaagacaaaactacattgaagaccttcagaatggtcctatcagaaagaattggaattccagtgtacccaggtcaagtgattttgaagactcagcacatctcatgcaaccagtccacaataagcctgttaaacaaggacctaggtataatctacatcagatccagggtcactcagctcctcgacatttccacacccagacccaaagtttgcaacaatcagtcagaaaattttcagagaatccacatgtttaccagagacaccatctccctcctcctggtccccctggagaggactattcacacaggaggtattcttggaatgtgaagcccaatgccagtcgggcagcccaggatagaagaaggtggtatccttataattactccagactctcctatccagcctgttgggaatggacccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) - defective in sister chromatid cohesion 1 homolog (S. cerevisiae) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 - solute carrier family 22 (organic anion transporter), member 6 |