Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CIAO1-cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene
PTXBC001395
New product
Data sheet of CIAO1-cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CIAO1-cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001395 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CIAO1 |
| Origin species: | Human |
| Product name: | CIAO1-cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001395 |
| Gene id: | 9391 |
| Gene description: | cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) |
| Synonyms: | WD40 protein Ciao1; CIA1; WDR39; WD repeat domain 39; WD repeat-containing protein 39; cytosolic iron-sulfur protein assembly 1 homolog; cytosolic iron-sulfur assembly component 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggactcgctggtgctgctgggccgtgtcccggcgcacccggactcccgctgctggttcctggcctggaaccccgcggggaccctgctggcctcgtgcggcggcgaccggagaatccgcatctggggcacggagggtgacagctggatctgcaagtctgtcctttctgaaggccaccagcgcaccgtgcggaaggtagcctggtccccctgcggtaattacctggcctctgccagctttgatgctaccacttgcatttggaagaagaaccaggatgactttgagtgtgtaaccactctcgagggccatgaaaatgaggtcaagtcagtggcttgggccccatctggcaacctcctggccacttgcagccgagataagagcgtttgggtctgggaagttgatgaagaggatgagtatgaatgtgtcagtgttctcaactcccacacacaggatgtcaagcatgtggtttggcacccaagtcaggagctcttagcttctgccagctatgatgacacagtgaagctgtaccgggaggaagaggatgactgggtatgctgtgccacccttgagggccatgaatccactgtgtggagcttggcctttgacccgagtggccagcgcctggcgtcttgtagtgatgaccgtactgtgcgtatctggcgtcagtatctaccaggcaatgaacaaggggtggcatgcagcggctctgaccccagttggaaatgtatctgtactttgtccggcttccactcaaggaccatttatgacattgcttggtgtcagctgacaggggctctggccacagcttgtggggatgacgcgatccgcgtgtttcaggaggatcccaactcggatccacagcagcccaccttctccctgacagcccacttgcatcaggcccattcccaggatgtcaactgtgtggcctggaaccccaaggagccagggctactggcctcctgcagtgatgatggggaggtggccttctggaagtatcagcggcctgaaggcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - defective in sister chromatid cohesion 1 homolog (S. cerevisiae) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 - solute carrier family 22 (organic anion transporter), member 6 - BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) |