NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene View larger

NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007067
Product type: DNA & cDNA
Ncbi symbol: NSL1
Origin species: Human
Product name: NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC007067
Gene id: 25936
Gene description: NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
Synonyms: NSL1, MIS12 kinetochore complex component; NSL1, MIND kinetochore complex component, homolog; kinetochore-associated protein NSL1 homolog; C1orf48; DC8; MIS14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggggtttcctgagttggtggtccttgaccctccatgggacaaggagctcgcggctggcacagagagccaggccttggtctccgccactccccgagaagactttcgggtgcgctgcacctcgaagcgggctgtgaccgaaatgctacaactgtgcggccgcttcgtgcaaaagctcggggacgctctgccggaggagattcgggagcccgctctgcgagatgcgcagtggacttttgaatcagctgtgcaagagaatatcagcattaatgggcaagcatggcaggaagcttcagataattgttttatggattctgacatcaaagtacttgaagatcagtttgatgaaatcatagtagatatagccacaaaacgtaagcagtatcccagaaagatcctggaatgtgtcatcaaaaccataaaagcaaaacaagaaattctgaagcagtaccaccctgttgtacatccactggacctaaaatatgaccctgatccagcccctcatatggaaaatttgaaatgcagaggggaaacagtagcaaaggagatcagtgaagccatgaagtccttgcctgcattaattgaacaaggagagggattttcccaagttctcaggatgcagcctgttatccacctccagaggattcaccaagaagtcttttccagttgtcataggaaaccagatgctaaacctgagaactttataacacagatagaaaccacaccaacagagactgcttccaggaaaacctctgacgtggtactgaaaagaaagcaaactaaagactgcccccagagaaaatggtatccattgcggccaaagaaaattaatcttgatacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
- cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)
- defective in sister chromatid cohesion 1 homolog (S. cerevisiae)
- dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4

Buy NSL1-NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Gene now

Add to cart