Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene
PTXBC025383
New product
Data sheet of SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025383 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SOHLH2 |
| Origin species: | Human |
| Product name: | SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene |
| Size: | 2ug |
| Accessions: | BC025383 |
| Gene id: | 54937 |
| Gene description: | spermatogenesis and oogenesis specific basic helix-loop-helix 2 |
| Synonyms: | SOSF2; SPATA28; TEB1; bHLHe81; spermatogenesis- and oogenesis-specific basic helix-loop-helix-containing protein 2; spermatogenesis associated 28; testicular secretory protein Li 50; testicular secretory protein Li 51; spermatogenesis and oogenesis specific basic helix-loop-helix 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcctcaattatctgccaggagcactgccagatctcgggccaggcaaaaatagacatcttattagttggagatgtcactgtgggctacctggctgatactgtacagaaactatttgcaaacatagcagaagtcaccatcaccatcagtgacacgaaggaggcagcagcgcttttggatgattgcatattcaacatggttctcttgaaggtgccttcttcactaagtgccgaggagctggaagccatcaagttaattagatttggcaaaaagaaaaatacacattcactgtttgtttttataatccctgaaaattttaaaggttgtatttcagggcatggaatggatattgctttaactgaaccactgacaatggaaaaaatgagtaatgtggtaaaatactggacaacatgtccctcaaacactgttaagactgaaaacgcaactgggcctgaagaacttggattgcccctgcagaggtcctacagcgaacacctgggatattttcctactgatctatttgcctgctctgaatctttaaggaatggcaatgggcttgaattaaatgcttcgttgtcagagttcgagaaaaacaaaaagatctctcttcttcattcaagcaaggaaaaactaagaaggctgtacaggaagcatagcagcttctgtttctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UTP23, small subunit (SSU) processome component, homolog (yeast) - proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) - NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) - dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) |