SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene View larger

SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025383
Product type: DNA & cDNA
Ncbi symbol: SOHLH2
Origin species: Human
Product name: SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene
Size: 2ug
Accessions: BC025383
Gene id: 54937
Gene description: spermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms: SOSF2; SPATA28; TEB1; bHLHe81; spermatogenesis- and oogenesis-specific basic helix-loop-helix-containing protein 2; spermatogenesis associated 28; testicular secretory protein Li 50; testicular secretory protein Li 51; spermatogenesis and oogenesis specific basic helix-loop-helix 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcctcaattatctgccaggagcactgccagatctcgggccaggcaaaaatagacatcttattagttggagatgtcactgtgggctacctggctgatactgtacagaaactatttgcaaacatagcagaagtcaccatcaccatcagtgacacgaaggaggcagcagcgcttttggatgattgcatattcaacatggttctcttgaaggtgccttcttcactaagtgccgaggagctggaagccatcaagttaattagatttggcaaaaagaaaaatacacattcactgtttgtttttataatccctgaaaattttaaaggttgtatttcagggcatggaatggatattgctttaactgaaccactgacaatggaaaaaatgagtaatgtggtaaaatactggacaacatgtccctcaaacactgttaagactgaaaacgcaactgggcctgaagaacttggattgcccctgcagaggtcctacagcgaacacctgggatattttcctactgatctatttgcctgctctgaatctttaaggaatggcaatgggcttgaattaaatgcttcgttgtcagagttcgagaaaaacaaaaagatctctcttcttcattcaagcaaggaaaaactaagaaggctgtacaggaagcatagcagcttctgtttctggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UTP23, small subunit (SSU) processome component, homolog (yeast)
- proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
- NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
- dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)

Buy SOHLH2-spermatogenesis and oogenesis specific basic helix-loop-helix 2 Gene now

Add to cart