UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene View larger

UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene

PTXBC005955

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005955
Product type: DNA & cDNA
Ncbi symbol: UTP23
Origin species: Human
Product name: UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene
Size: 2ug
Accessions: BC005955
Gene id: 84294
Gene description: UTP23, small subunit (SSU) processome component, homolog (yeast)
Synonyms: UTP23, small subunit processome component; UTP23, small subunit (SSU) processome component, homolog; rRNA-processing protein UTP23 homolog; C8orf53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatcacaaggcagaaacatgccaagaagcatcttggcttcttccgcaacaacttcggagtccgcgagccgtaccagatcctgctggacggcaccttctgtcaggcggcgctgcggggccgcatccagctgcgggagcagctgccccgctacctcatgggggagacgcagctgtgcaccacaagatgtgtgttaaaagagctagaaacattgggaaaggacttatatggggcaaaactgattgcacaaaaatgccaagttcgaaattgtcctcatttcaagaatgcagtgagtggatcagaatgtctgctttccatggttgaagagggaaatcctcatcattattttgtggcaacacaggatcagaatttgtctgtgaaagtaaaaaagaagcctggagttcctctcatgtttattattcagaacactatggttttggacaaaccttctcccaaaacaattgcctttgtaaaagcagtggagtcaggtcagcttgtctcagtgcatgagaaagaaagtatcaaacatctcaaagaggaacagggtttagtgaaaaacactgaacagagtagaagaaaaaagcgcaagaaaataagtggtcccaatcctcttagttgtttgaagaaaaagaaaaaggcaccggacacacaatcatctgcttctgaaaagagaagaaaaagaaaaagaattcggaacagatctaacccaaaagtactttctgagaagcagaatgcagaaggagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
- NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)
- dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)
- cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)

Buy UTP23-UTP23, small subunit (SSU) processome component, homolog (yeast) Gene now

Add to cart