Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FAM103A1-family with sequence similarity 103, member A1 Gene
PTXBC003627
New product
Data sheet of FAM103A1-family with sequence similarity 103, member A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM103A1-family with sequence similarity 103, member A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003627 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM103A1 |
| Origin species: | Human |
| Product name: | FAM103A1-family with sequence similarity 103, member A1 Gene |
| Size: | 2ug |
| Accessions: | BC003627 |
| Gene id: | 83640 |
| Gene description: | family with sequence similarity 103, member A1 |
| Synonyms: | protein FAM103A1; C15orf18; HsT19360; RAM; RNMT-activating mini protein; family with sequence similarity 103 member A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgacactgccgaagctgttccaaagtttgaagagatgtttgctagtagattcacagaaaatgacaaggagtatcaggaatacctgaaacgccctcctgagtctcctccaattgttgaggaatggaatagcagagctggtgggaaccaaagaaacagaggcaatcggttgcaagacaacagacagttcagaggcagggacaacagatgggggtggccaagtgacaatcgatccaatcagtggcatggacgatcctggggtaacaactacccgcaacacagacaagaaccttactatccccagcaatatggacattatggttacaaccagcggcctccttacggttactactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PEST proteolytic signal containing nuclear protein - V-set and transmembrane domain containing 2 like - pseudouridylate synthase 7 homolog (S. cerevisiae) - chromobox homolog 2 (Pc class homolog, Drosophila) |