FAM103A1-family with sequence similarity 103, member A1 Gene View larger

FAM103A1-family with sequence similarity 103, member A1 Gene

PTXBC003627

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM103A1-family with sequence similarity 103, member A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM103A1-family with sequence similarity 103, member A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003627
Product type: DNA & cDNA
Ncbi symbol: FAM103A1
Origin species: Human
Product name: FAM103A1-family with sequence similarity 103, member A1 Gene
Size: 2ug
Accessions: BC003627
Gene id: 83640
Gene description: family with sequence similarity 103, member A1
Synonyms: protein FAM103A1; C15orf18; HsT19360; RAM; RNMT-activating mini protein; family with sequence similarity 103 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgacactgccgaagctgttccaaagtttgaagagatgtttgctagtagattcacagaaaatgacaaggagtatcaggaatacctgaaacgccctcctgagtctcctccaattgttgaggaatggaatagcagagctggtgggaaccaaagaaacagaggcaatcggttgcaagacaacagacagttcagaggcagggacaacagatgggggtggccaagtgacaatcgatccaatcagtggcatggacgatcctggggtaacaactacccgcaacacagacaagaaccttactatccccagcaatatggacattatggttacaaccagcggcctccttacggttactactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PEST proteolytic signal containing nuclear protein
- V-set and transmembrane domain containing 2 like
- pseudouridylate synthase 7 homolog (S. cerevisiae)
- chromobox homolog 2 (Pc class homolog, Drosophila)

Buy FAM103A1-family with sequence similarity 103, member A1 Gene now

Add to cart