Login to display prices
Login to display prices
GAGE5-G antigen 5 Gene View larger

GAGE5-G antigen 5 Gene

PTXBC024914

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAGE5-G antigen 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GAGE5-G antigen 5 Gene

Proteogenix catalog: PTXBC024914
Ncbi symbol: GAGE5
Product name: GAGE5-G antigen 5 Gene
Size: 2ug
Accessions: BC024914
Gene id: 2577
Gene description: G antigen 5
Synonyms: CT4.5; G antigen 5; GAGE-5; cancer/testis antigen 4.5; cancer/testis antigen family 4, member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggcgaggaagatcgacctattattggcctagaccaaggcgctatgtacagcctcctgaagtgattgggcctatgcggcccgagcagttcagtgatgaagtggaaccagcaacacctgaagaaggggaaccagcaactcaacgtcaggatcctgcagctgctcaggagggagaggatgagggagcatctgcaggtcaagggccgaagcctgaagctgatagccaggaacagggtcacccacagactgggtgtgagtgtgaagatggtcctgatgggcaggagatggacccgccaaatccagaggaggtgaaaacgcctgaagaaggtgaaaagcaatcacagtgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: