Login to display prices
Login to display prices
CXCL5-chemokine (C-X-C motif) ligand 5 Gene View larger

CXCL5-chemokine (C-X-C motif) ligand 5 Gene

PTXBC008376

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL5-chemokine (C-X-C motif) ligand 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL5-chemokine (C-X-C motif) ligand 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008376
Product type: DNA & cDNA
Ncbi symbol: CXCL5
Origin species: Human
Product name: CXCL5-chemokine (C-X-C motif) ligand 5 Gene
Size: 2ug
Accessions: BC008376
Gene id: 6374
Gene description: chemokine (C-X-C motif) ligand 5
Synonyms: ENA-78; SCYB5; C-X-C motif chemokine 5; chemokine (C-X-C motif) ligand 5; epithelial-derived neutrophil-activating protein 78; neutrophil-activating peptide ENA-78; neutrophil-activating protein 78; small inducible cytokine subfamily B (Cys-X-Cys), member 5 (epithelial-derived neutrophil-activating peptide 78); C-X-C motif chemokine ligand 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcctgtccagccgcgcggcccgtgtccccggtccttcgagctccttgtgcgcgctgttggtgctgctgctgctgctgacgcagccagggcccatcgccagcgctggtcctgccgctgctgtgttgagagagctgcgttgcgtttgtttacagaccacgcaaggagttcatcccaaaatgatcagtaatctgcaagtgttcgccataggcccacagtgctccaaggtggaagtggtagcctccctgaagaacgggaaggaaatttgtcttgatccagaagccccttttctaaagaaagtcatccagaaaattttggacggtggaaacaaggaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WAP four-disulfide core domain 5
- RAD51 homolog C (S. cerevisiae)
- hypothetical protein FLJ14107
- myosin, heavy chain 9, non-muscle