Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCL5-chemokine (C-X-C motif) ligand 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL5-chemokine (C-X-C motif) ligand 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008376 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL5 |
| Origin species: | Human |
| Product name: | CXCL5-chemokine (C-X-C motif) ligand 5 Gene |
| Size: | 2ug |
| Accessions: | BC008376 |
| Gene id: | 6374 |
| Gene description: | chemokine (C-X-C motif) ligand 5 |
| Synonyms: | ENA-78; SCYB5; C-X-C motif chemokine 5; chemokine (C-X-C motif) ligand 5; epithelial-derived neutrophil-activating protein 78; neutrophil-activating peptide ENA-78; neutrophil-activating protein 78; small inducible cytokine subfamily B (Cys-X-Cys), member 5 (epithelial-derived neutrophil-activating peptide 78); C-X-C motif chemokine ligand 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcctgtccagccgcgcggcccgtgtccccggtccttcgagctccttgtgcgcgctgttggtgctgctgctgctgctgacgcagccagggcccatcgccagcgctggtcctgccgctgctgtgttgagagagctgcgttgcgtttgtttacagaccacgcaaggagttcatcccaaaatgatcagtaatctgcaagtgttcgccataggcccacagtgctccaaggtggaagtggtagcctccctgaagaacgggaaggaaatttgtcttgatccagaagccccttttctaaagaaagtcatccagaaaattttggacggtggaaacaaggaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WAP four-disulfide core domain 5 - RAD51 homolog C (S. cerevisiae) - hypothetical protein FLJ14107 - myosin, heavy chain 9, non-muscle |