Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAD51C-RAD51 homolog C (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAD51C-RAD51 homolog C (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000667 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAD51C |
| Origin species: | Human |
| Product name: | RAD51C-RAD51 homolog C (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000667 |
| Gene id: | 5889 |
| Gene description: | RAD51 homolog C (S. cerevisiae) |
| Synonyms: | BROVCA3; FANCO; R51H3; RAD51L2; DNA repair protein RAD51 homolog 3; RAD51-like protein 2; yeast RAD51 homolog 3; RAD51 paralog C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgcgggaagacgttccgctttgaaatgcagcgggatttggtgagtttcccgctgtctccagcggtgcgggtgaagctggtgtctgcggggttccagactgctgaggaactcctagaggtgaaaccctccgagcttagcaaagaagttgggatatctaaagcagaagccttagaaactctgcaaattatcagaagagaatgtctcacaaataaaccaagatatgctggtacatctgagtcacacaagaagtgtacagcactggaacttcttgagcaggagcatacccagggcttcataatcaccttctgttcagcactagatgatattcttgggggtggagtgcccttaatgaaaacaacagaaatttgtggtgcaccaggtgttggaaaaacacaattatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ14107 - myosin, heavy chain 9, non-muscle - coactosin-like 1 (Dictyostelium) - hypothetical protein MGC31957 |