Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MYH9-myosin, heavy chain 9, non-muscle Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYH9-myosin, heavy chain 9, non-muscle Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011915 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYH9 |
| Origin species: | Human |
| Product name: | MYH9-myosin, heavy chain 9, non-muscle Gene |
| Size: | 2ug |
| Accessions: | BC011915 |
| Gene id: | 4627 |
| Gene description: | myosin, heavy chain 9, non-muscle |
| Synonyms: | BDPLT6; DFNA17; EPSTS; FTNS; MHA; NMHC-II-A; NMMHC-IIA; NMMHCA; myosin-9; cellular myosin heavy chain, type A; myosin, heavy chain 9, non-muscle; non-muscle myosin heavy chain 9; non-muscle myosin heavy chain A; non-muscle myosin heavy chain IIa; non-muscle myosin heavy polypeptide 9; nonmuscle myosin heavy chain II-A; myosin heavy chain 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaagcggatggggctgaggccaaacctgccgaataagcctcttctcctgcagcctgagatggatggacagacagacaccacagcctccccttcccagaccccgcagcacgcctctccccaccttcttgggactgctgtgaacatgcctcctcctgccctccgccccgtccccccatcccgtttccctccaggtgttgttgagggcatttggcttcctctgctgcatccccttccagctccctcccctgctcagaatctgataccaaagagacagggcccgggcccaggcagagagcgaccagcaggctcctcagccctctcttgccaaaaagcacaagatgttgaggcgagcagggcaggcccccggggaggggccagagttttctatgaatctatttttcttcagactgaggccttttggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coactosin-like 1 (Dictyostelium) - hypothetical protein MGC31957 - myosin, light chain 7, regulatory - ubiquitin-conjugating enzyme E2C |