FLJ14107-hypothetical protein FLJ14107 Gene View larger

FLJ14107-hypothetical protein FLJ14107 Gene

PTXBC013100

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FLJ14107-hypothetical protein FLJ14107 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLJ14107-hypothetical protein FLJ14107 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013100
Product type: DNA & cDNA
Ncbi symbol: FLJ14107
Origin species: Human
Product name: FLJ14107-hypothetical protein FLJ14107 Gene
Size: 2ug
Accessions: BC013100
Gene id: 80094
Gene description: hypothetical protein FLJ14107
Synonyms: BIN3 intronic transcript 1 (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcctctccactggagaaggattttcatctgccaggtggcggggcccttagcctcgttaatcctgcttaatcctgctagaacatacctacagggagcccactttccacgcagagcatcccttgaaggaggggcttcccagaatgctgaggattctgggcttctcagactccgatcagatgcacctcagccctgggatcagtgccccagccctgcctgccagtttcctttttcacttcaccatgagcataagtttgggtgggaactcagcctgttcattcacttcatactgagttcccactctgtgccagggcctgacctgtgcactgccaaaagagcagggaacagcaaaaccctttcctcccaccgtgggccttggagaatgaatgcagggggtggccacgggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin, heavy chain 9, non-muscle
- coactosin-like 1 (Dictyostelium)
- hypothetical protein MGC31957
- myosin, light chain 7, regulatory

Buy FLJ14107-hypothetical protein FLJ14107 Gene now

Add to cart