Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of WFDC5-WAP four-disulfide core domain 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WFDC5-WAP four-disulfide core domain 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039173 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WFDC5 |
| Origin species: | Human |
| Product name: | WFDC5-WAP four-disulfide core domain 5 Gene |
| Size: | 2ug |
| Accessions: | BC039173 |
| Gene id: | 149708 |
| Gene description: | WAP four-disulfide core domain 5 |
| Synonyms: | PRG5; WAP1; dJ211D12.5; WAP four-disulfide core domain protein 5; p53-responsive gene 5 protein; protease inhibitor WAP1; WAP four-disulfide core domain 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggacccagagccttctcctcctgggggccctcctggctgtggggagtcagctgcctgctgtctttggcaggaagaagggagagaaatcggggggctgcccgccagatgatgggccctgcctcctatcggtgcctgaccagtgcgtggaagacagccagtgtcccttgaccaggaagtgctgctacagagcttgcttccgccagtgtgtccccagggtctctgtgaagctgggcagctgcccagaggaccaactgcgctgcctcagccccatgaaccacctgtgtcacaaggactcagactgctcgggcaaaaagcgatgctgccacagcgcctgcgggcgggattgccgggatcctgccagaggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAD51 homolog C (S. cerevisiae) - hypothetical protein FLJ14107 - myosin, heavy chain 9, non-muscle - coactosin-like 1 (Dictyostelium) |