Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene
PTXBC013744
New product
Data sheet of CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013744 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL6 |
| Origin species: | Human |
| Product name: | CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene |
| Size: | 2ug |
| Accessions: | BC013744 |
| Gene id: | 6372 |
| Gene description: | chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) |
| Synonyms: | CKA-3; GCP-2; GCP2; SCYB6; C-X-C motif chemokine 6; Small inducible cytokine subfamily B (Cys-X-Cys), member b; chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2); chemokine alpha 3; granulocyte chemotactic protein 2; small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2); small-inducible cytokine B6; C-X-C motif chemokine ligand 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaaccccaaaacgattggtaaactgcaggtgttccccgcaggcccgcagtgctccaaggtggaagtggtagcctccctgaagaacgggaagcaagtttgtctggacccggaagccccttttctaaagaaagtcatccagaaaattttggacagtggaaacaagaaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inhibitor of DNA binding 2, dominant negative helix-loop-helix protein - succinate dehydrogenase complex, subunit D, integral membrane protein - RNA binding motif protein, Y-linked, family 2, member F pseudogene - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) |