Login to display prices
Login to display prices
CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene View larger

CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene

PTXBC013744

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene

Proteogenix catalog: PTXBC013744
Ncbi symbol: CXCL6
Product name: CXCL6-chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) Gene
Size: 2ug
Accessions: BC013744
Gene id: 6372
Gene description: chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)
Synonyms: CKA-3; GCP-2; GCP2; SCYB6; C-X-C motif chemokine 6; Small inducible cytokine subfamily B (Cys-X-Cys), member b; chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2); chemokine alpha 3; granulocyte chemotactic protein 2; small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2); small-inducible cytokine B6; C-X-C motif chemokine ligand 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaaccccaaaacgattggtaaactgcaggtgttccccgcaggcccgcagtgctccaaggtggaagtggtagcctccctgaagaacgggaagcaagtttgtctggacccggaagccccttttctaaagaaagtcatccagaaaattttggacagtggaaacaagaaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: