Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene
PTXBC026077
New product
Data sheet of RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026077 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBMY2FP |
| Origin species: | Human |
| Product name: | RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC026077 |
| Gene id: | 159162 |
| Gene description: | RNA binding motif protein, Y-linked, family 2, member F pseudogene |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtagaagcagatcgtcctggcaagcatttcattggtggcctaaatagggaaaacaatgaaaagatgtttaaagcagtatttgcgaaacatggtcccatatcagaagttcttttgataaaggatcgaaccagcaaatccagaggctttgcatttactacttttgagaacactgcagatgctaagaatgctgccaaacatatgattggaaagcctttggatggaaaagcaataaaagtagaacaagccaagaaaccatcttttcaaagtggtggtaggcagagaccaccagcttcctcaagaagcagaagcccttcaggatgtctgagatctgcaagaggaagtagtggaggaacaagaggatggcatccctcacatgaaggacgcttgggtaatgttttaaaatgtaaagatggaaccataggactgaaagaaaataagtttgaagatatcgaaatttctcaattatatttatttcctttatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) - VAMP (vesicle-associated membrane protein)-associated protein B and C - proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) - UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) |