Login to display prices
Login to display prices
RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene View larger

RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

PTXBC026077

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026077
Product type: DNA & cDNA
Ncbi symbol: RBMY2FP
Origin species: Human
Product name: RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene
Size: 2ug
Accessions: BC026077
Gene id: 159162
Gene description: RNA binding motif protein, Y-linked, family 2, member F pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagaagcagatcgtcctggcaagcatttcattggtggcctaaatagggaaaacaatgaaaagatgtttaaagcagtatttgcgaaacatggtcccatatcagaagttcttttgataaaggatcgaaccagcaaatccagaggctttgcatttactacttttgagaacactgcagatgctaagaatgctgccaaacatatgattggaaagcctttggatggaaaagcaataaaagtagaacaagccaagaaaccatcttttcaaagtggtggtaggcagagaccaccagcttcctcaagaagcagaagcccttcaggatgtctgagatctgcaagaggaagtagtggaggaacaagaggatggcatccctcacatgaaggacgcttgggtaatgttttaaaatgtaaagatggaaccataggactgaaagaaaataagtttgaagatatcgaaatttctcaattatatttatttcctttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
- VAMP (vesicle-associated membrane protein)-associated protein B and C
- proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
- UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)