Login to display prices
Login to display prices
RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene View larger

RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

PTXBC026077

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene

Proteogenix catalog: PTXBC026077
Ncbi symbol: RBMY2FP
Product name: RBMY2FP-RNA binding motif protein, Y-linked, family 2, member F pseudogene Gene
Size: 2ug
Accessions: BC026077
Gene id: 159162
Gene description: RNA binding motif protein, Y-linked, family 2, member F pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagaagcagatcgtcctggcaagcatttcattggtggcctaaatagggaaaacaatgaaaagatgtttaaagcagtatttgcgaaacatggtcccatatcagaagttcttttgataaaggatcgaaccagcaaatccagaggctttgcatttactacttttgagaacactgcagatgctaagaatgctgccaaacatatgattggaaagcctttggatggaaaagcaataaaagtagaacaagccaagaaaccatcttttcaaagtggtggtaggcagagaccaccagcttcctcaagaagcagaagcccttcaggatgtctgagatctgcaagaggaagtagtggaggaacaagaggatggcatccctcacatgaaggacgcttgggtaatgttttaaaatgtaaagatggaaccataggactgaaagaaaataagtttgaagatatcgaaatttctcaattatatttatttcctttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice