Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene
PTXBC013064
New product
Data sheet of UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013064 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UTP15 |
| Origin species: | Human |
| Product name: | UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC013064 |
| Gene id: | 84135 |
| Gene description: | UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) |
| Synonyms: | UTP15, small subunit processome component; UTP15, U3 small nucleolar ribonucleoprotein, homolog; UTP15 SSU processome component; NET21; U3 small nucleolar RNA-associated protein 15 homolog; Src-associated protein SAW |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttaaaaggaggacaattgctagtatctttgaaaaatcatcacaaaaccgtgacatgtttatgtctaagcagctctggacagaggttactctctggctcactggataggaaggtgaaagtatacagcacaacttcctacaaagtagtccacagttttgattatgcagcttcaattttgagtcttgcccttgcacatgaagatgagacaatagttgtaggaatgaccaatggaatactgagtgttaaacatcggaaatctgaagcaaagaaggaatcacttcccagaagaagaaggcctgcatatcgaacctttattaaaggaaaaaattacatgaagcaacgggatgacattttgattaacaggccagcaaagaagcacctagaattgtatgacagggatctgaaacattttcggatctctaaggcactcgatagagttcttgatcccacttgtacaataaagacacccgagattacggtgtccatcataaaggagttaaatcgaagaggcgtccttgcaaatgcgcttgcaggtcgggatgagaaggaaatcagtcatgttcttaattttttgataaggaatctttctcagccaagatttgcccctgttttaatcaatgctgctgaaataattattgatatatatctgcctgtaattggtcagtcccctgtagttgataaaaagtttttactacttcaaggacttgtagaaaaagagattgattaccaaagagaattgttagaaaccttggggatgatggatatgctttttgccaccatgagaaggaaggaaggcacttctgtgttggaacacacatctgatggatttccagagaataagaagatagaatcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) - small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha - gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) - protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma |