UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene View larger

UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene

PTXBC013064

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013064
Product type: DNA & cDNA
Ncbi symbol: UTP15
Origin species: Human
Product name: UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC013064
Gene id: 84135
Gene description: UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
Synonyms: UTP15, small subunit processome component; UTP15, U3 small nucleolar ribonucleoprotein, homolog; UTP15 SSU processome component; NET21; U3 small nucleolar RNA-associated protein 15 homolog; Src-associated protein SAW
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttaaaaggaggacaattgctagtatctttgaaaaatcatcacaaaaccgtgacatgtttatgtctaagcagctctggacagaggttactctctggctcactggataggaaggtgaaagtatacagcacaacttcctacaaagtagtccacagttttgattatgcagcttcaattttgagtcttgcccttgcacatgaagatgagacaatagttgtaggaatgaccaatggaatactgagtgttaaacatcggaaatctgaagcaaagaaggaatcacttcccagaagaagaaggcctgcatatcgaacctttattaaaggaaaaaattacatgaagcaacgggatgacattttgattaacaggccagcaaagaagcacctagaattgtatgacagggatctgaaacattttcggatctctaaggcactcgatagagttcttgatcccacttgtacaataaagacacccgagattacggtgtccatcataaaggagttaaatcgaagaggcgtccttgcaaatgcgcttgcaggtcgggatgagaaggaaatcagtcatgttcttaattttttgataaggaatctttctcagccaagatttgcccctgttttaatcaatgctgctgaaataattattgatatatatctgcctgtaattggtcagtcccctgtagttgataaaaagtttttactacttcaaggacttgtagaaaaagagattgattaccaaagagaattgttagaaaccttggggatgatggatatgctttttgccaccatgagaaggaaggaaggcacttctgtgttggaacacacatctgatggatttccagagaataagaagatagaatcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
- small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
- gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma

Buy UTP15-UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae) Gene now

Add to cart