NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene View larger

NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013026
Product type: DNA & cDNA
Ncbi symbol: NUS1
Origin species: Human
Product name: NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC013026
Gene id: 116150
Gene description: nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Synonyms: NUS1 dehydrodolichyl diphosphate synthase subunit; dehydrodolichyl diphosphate syntase complex subunit NUS1; dehydrodolichyl diphosphate synthase complex subunit NUS1; C6orf68; CDG1AA; MGC:7199; NgBR; TANGO14; Nogo-B receptor; di-trans,poly-cis-decaprenylcistransferase; nuclear undecaprenyl pyrophosphate synthase 1 homolog; transport and golgi organization 14 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggggctgtacgagctggtgtggcgggtgctgcacgcgctgctctgtctgcaccgcacgctcacctcctggctccgcgttcggttcggcacctggaactggatctggcggcgctgctgccgcgccgcctctgccgcggtcctagcgccgctcggcttcacgctccgcaagcccccggcagtcggcaggaaccgccgtcaccaccggcacccgcgcggggggtcgtgcctggcagccgcacaccaccggatgcgctggcgcgcggacggtcgttccttggagaagctgcctgtgcatatgggcctggtgatcaccgaggtggagcaggaacccagcttctcggacatcgcgagcctcgtggtgtggtgtatggccgtgggcatctcctacattagcgtctacgaccaccaaggtattttcaaaagaaataattccagattgatggatgaaattttaaaacaacagcaagaacttctgggcctagattgttcaaaatactcaccagaatttgcaaatagtaatgacaaagatgatcaagttttaaattgccatttggcagtgaaggtgctgtctccggaagatggaaaagcagatattgtaagagctgctcaggacttttgccagttagtagcccagaagcaaaagagacccacagatttggatgtagatacgttagccagtttacttagttcaaatggttgtcctgatcctgatttagtattgaagttcggtcctgtggacagcacattaggctttcttccctggcacatcagattgactgagattgtctctttgccttcccacctaaacatcagttatgaggactttttctctgcccttcgtcaatatgcagcctgtgaacagcgtctgggaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
- gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma
- sorting and assembly machinery component 50 homolog (S. cerevisiae)

Buy NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene now

Add to cart