Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene
PTXBC013026
New product
Data sheet of NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013026 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUS1 |
| Origin species: | Human |
| Product name: | NUS1-nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC013026 |
| Gene id: | 116150 |
| Gene description: | nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) |
| Synonyms: | NUS1 dehydrodolichyl diphosphate synthase subunit; dehydrodolichyl diphosphate syntase complex subunit NUS1; dehydrodolichyl diphosphate synthase complex subunit NUS1; C6orf68; CDG1AA; MGC:7199; NgBR; TANGO14; Nogo-B receptor; di-trans,poly-cis-decaprenylcistransferase; nuclear undecaprenyl pyrophosphate synthase 1 homolog; transport and golgi organization 14 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggggctgtacgagctggtgtggcgggtgctgcacgcgctgctctgtctgcaccgcacgctcacctcctggctccgcgttcggttcggcacctggaactggatctggcggcgctgctgccgcgccgcctctgccgcggtcctagcgccgctcggcttcacgctccgcaagcccccggcagtcggcaggaaccgccgtcaccaccggcacccgcgcggggggtcgtgcctggcagccgcacaccaccggatgcgctggcgcgcggacggtcgttccttggagaagctgcctgtgcatatgggcctggtgatcaccgaggtggagcaggaacccagcttctcggacatcgcgagcctcgtggtgtggtgtatggccgtgggcatctcctacattagcgtctacgaccaccaaggtattttcaaaagaaataattccagattgatggatgaaattttaaaacaacagcaagaacttctgggcctagattgttcaaaatactcaccagaatttgcaaatagtaatgacaaagatgatcaagttttaaattgccatttggcagtgaaggtgctgtctccggaagatggaaaagcagatattgtaagagctgctcaggacttttgccagttagtagcccagaagcaaaagagacccacagatttggatgtagatacgttagccagtttacttagttcaaatggttgtcctgatcctgatttagtattgaagttcggtcctgtggacagcacattaggctttcttccctggcacatcagattgactgagattgtctctttgccttcccacctaaacatcagttatgaggactttttctctgcccttcgtcaatatgcagcctgtgaacagcgtctgggaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha - gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) - protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma - sorting and assembly machinery component 50 homolog (S. cerevisiae) |