Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GGH-gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) Gene
PTXBC025025
New product
Data sheet of GGH-gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GGH-gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025025 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GGH |
| Origin species: | Human |
| Product name: | GGH-gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) Gene |
| Size: | 2ug |
| Accessions: | BC025025 |
| Gene id: | 8836 |
| Gene description: | gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) |
| Synonyms: | gamma-glutamyl hydrolase; gamma-Glu-X carboxypeptidase; gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagtccgggctgcctgctgtgcgtgctgggcctgctactctgcggggcggcgagcctcgagctgtctagaccccacggcgacaccgccaagaagcccatcatcggaatattaatgcaaaaatgccgtaataaagtcatgaaaaactatggaagatactatattgctgcgtcctatgtaaagtacttggagtctgcaggtgcgagagttgtaccagtaaggctggatcttacagagaaagactatgaaatacttttcaaatctattaatggaatccttttccctggaggaagtgttgacctcagacgctcagattatgctaaagtggccaaaatattttataacttgtccatacagagttttgatgatggagactattttcctgtgtggggcacatgccttggatttgaagagctttcactgctgattagtggagagtgcttattaactgccacagatactgttgacgtggcaatgccgctgaacttcactggaggtcaattgcacagcagaatgttccagaattttcctactgagttgttgctgtcattagcagtagaacctctgactgccaatttccataagtggagcctctccgtgaagaattttacaatgaatgaaaagttaaagaagtttttcaatgtcttaactacaaatacagatggcaagattgagtttatttcaacaatggaaggatataagtatccagtatatggtgtccagtggcatccagagaaagcaccttatgagtggaagaatttggatggcatttcccatgcacctaatgctgtgaaaaccgcattttatttagcagagttttttgttaatgaagctcggaaaaacaaccatcattttaaatctgaatctgaagaggagaaagcattgatttatcagttcagtccaatttatactggaaatatttcttcatttcagcaatgttacatatttgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma - sorting and assembly machinery component 50 homolog (S. cerevisiae) - solute carrier family 2 (facilitated glucose transporter), member 3 - feline leukemia virus subgroup C cellular receptor family, member 2 |