SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene View larger

SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene

PTXBC000390

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000390
Product type: DNA & cDNA
Ncbi symbol: SGTA
Origin species: Human
Product name: SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene
Size: 2ug
Accessions: BC000390
Gene id: 6449
Gene description: small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Synonyms: SGT; alphaSGT; hSGT; small glutamine-rich tetratricopeptide repeat-containing protein alpha; UBP; alpha-SGT; protein containing three tetratricopeptide repeats; small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha; vpu-binding protein; small glutamine rich tetratricopeptide repeat containing alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaacaagaagcgcctggcctacgccatcatccagttcctgcatgaccagctccggcacgggggcctctcgtccgatgctcaggagagcttggaagtcgccatccagtgcctggagactgcgtttggggtgacggtagaagacagtgaccttgcgctccctcagactctgccggagatatttgaagcggctgccacgggcaaggagatgccgcaggacctgaggagccccgcgcgaaccccgccttccgaggaggactcagcagaggcagagcgcctcaaaaccgaaggaaacgagcagatgaaagtggaaaactttgaagctgccgtgcatttctacggaaaagccatcgagctcaacccagccaacgccgtctatttctgcaacagagccgcagcctacagcaaactcggcaactacgcaggcgcggtgcaggactgtgagcgggccatctgcattgacccggcctacagcaaggcctacggcaggatgggcctggcgctctccagcctcaacaagcacgtggaggccgtggcttactacaagaaggctctggagctggaccccgacaacgagacatacaagtccaacctcaagatagcggagctgaagctgcgggaggcccccagccccacgggaggcgtgggcagcttcgacatcgccggcctgctgaacaaccctggcttcatgagcatggcttcgaacctaatgaacaatccccagattcagcagctcatgtccggcatgatttcgggtggcaacaaccccttgggaactcccggcaccagcccctcgcagaacgacctggccagcctcatccaggcgggccagcagtttgcccagcagatgcagcagcagaacccagagttgatagagcagctcaggagccagatccggagtcggacgcccagcgccagcaacgacgaccagcaggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)
- protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma
- sorting and assembly machinery component 50 homolog (S. cerevisiae)
- solute carrier family 2 (facilitated glucose transporter), member 3

Buy SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene now

Add to cart