Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene
PTXBC000390
New product
Data sheet of SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000390 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SGTA |
| Origin species: | Human |
| Product name: | SGTA-small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha Gene |
| Size: | 2ug |
| Accessions: | BC000390 |
| Gene id: | 6449 |
| Gene description: | small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha |
| Synonyms: | SGT; alphaSGT; hSGT; small glutamine-rich tetratricopeptide repeat-containing protein alpha; UBP; alpha-SGT; protein containing three tetratricopeptide repeats; small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha; vpu-binding protein; small glutamine rich tetratricopeptide repeat containing alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaacaagaagcgcctggcctacgccatcatccagttcctgcatgaccagctccggcacgggggcctctcgtccgatgctcaggagagcttggaagtcgccatccagtgcctggagactgcgtttggggtgacggtagaagacagtgaccttgcgctccctcagactctgccggagatatttgaagcggctgccacgggcaaggagatgccgcaggacctgaggagccccgcgcgaaccccgccttccgaggaggactcagcagaggcagagcgcctcaaaaccgaaggaaacgagcagatgaaagtggaaaactttgaagctgccgtgcatttctacggaaaagccatcgagctcaacccagccaacgccgtctatttctgcaacagagccgcagcctacagcaaactcggcaactacgcaggcgcggtgcaggactgtgagcgggccatctgcattgacccggcctacagcaaggcctacggcaggatgggcctggcgctctccagcctcaacaagcacgtggaggccgtggcttactacaagaaggctctggagctggaccccgacaacgagacatacaagtccaacctcaagatagcggagctgaagctgcgggaggcccccagccccacgggaggcgtgggcagcttcgacatcgccggcctgctgaacaaccctggcttcatgagcatggcttcgaacctaatgaacaatccccagattcagcagctcatgtccggcatgatttcgggtggcaacaaccccttgggaactcccggcaccagcccctcgcagaacgacctggccagcctcatccaggcgggccagcagtttgcccagcagatgcagcagcagaacccagagttgatagagcagctcaggagccagatccggagtcggacgcccagcgccagcaacgacgaccagcaggagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) - protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma - sorting and assembly machinery component 50 homolog (S. cerevisiae) - solute carrier family 2 (facilitated glucose transporter), member 3 |