POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004438
Product type: DNA & cDNA
Ncbi symbol: POP4
Origin species: Human
Product name: POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC004438
Gene id: 10775
Gene description: processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP4 homolog, ribonuclease P/MRP subunit; RPP29; ribonuclease P protein subunit p29; hPOP4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagtgtgatctaccatgcattgtctcagaaagaggcgaatgactccgatgtccagccttcaggagcacagcgggccgaggccttcgtgagggccttcctgaagcgcagcacgccccgcatgagcccgcaggcccgcgaggaccagctgcagcgcaaggcggtggtcctggagtacttcacccgccacaagcgcaaggagaagaagaagaaagccaaaggcctctctgccaggcaaaggagggagctgcggctctttgacattaaaccagagcagcagagatacagccttttcctccctctccatgaactctggaaacagtacatcagggacctgtgcagtgggctcaagccagacacgcagccacagatgattcaggccaagctcttaaaggcagatcttcacggggctattatttcagtgacaaaatccaaatgcccctcttatgtgggtattacaggaatccttctacaggaaacaaagcacattttcaaaattatcaccaaagaagaccgcctgaaagttatccccaagctaaactgcgtgttcactgtggaaaccgatggctttatttcctacatttacgggagcaaattccagcttcggtcaagtgaacggtctgcgaagaagttcaaagcgaagggaacaattgacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - VAMP (vesicle-associated membrane protein)-associated protein B and C
- proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
- UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)
- nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)

Buy POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene now

Add to cart