Login to display prices
Login to display prices
PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene View larger

PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene

PTXBC001423

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene

Proteogenix catalog: PTXBC001423
Ncbi symbol: PSME3
Product name: PSME3-proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) Gene
Size: 2ug
Accessions: BC001423
Gene id: 10197
Gene description: proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Synonyms: HEL-S-283; PA28-gamma; PA28G; PA28gamma; REG-GAMMA; proteasome activator complex subunit 3; 11S regulator complex gamma subunit; 11S regulator complex subunit gamma; Ki antigen; Ki nuclear autoantigen; PA28 gamma variant 5; REG gamma-3; activator of multicatalytic protease subunit 3; epididymis secretory protein Li 283; proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki); proteasome activator 28 subunit gamma; proteasome activator 28-gamma; proteasome activator subunit 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctcgttgctgaaggtggatcaggaagtgaagctcaaggttgattctttcagggagcggatcacaagtgaggcagaagacttggtggcaaattttttcccaaagaagttattagaacttgatagttttctgaaggaaccaatcttaaacatccatgacctaactcagatccactctgacatgaatctcccagtccctgaccccattcttctcaccaatagccatgatggactggatggtcccacttataagaagcgaaggttggatgagtgtgaagaagccttccaaggaaccaaggtgtttgtgatgcccaatgggatgctgaaaagcaaccagcagctggtggacattattgagaaagtgaaacctgagatccggctgttgattgagaaatgtaacacggtcaaaatgtgggtacagctcctgattcccaggatagaagatggaaacaactttggggtgtccattcaggaggaaacagttgcagagctaagaactgttgagagtgaagctgcatcttatctggaccagatttctagatattatattacaagagccaaattggtttctaaaatagctaaatatccccatgtggaggactatcgccgcaccgtgacagagattgatgagaaagaatatatcagccttcggctcatcatatcagagctgaggaatcaatatgtcactctacatgacatgatcctgaaaaatatcgagaagatcaaacggccccggagcagcaatgcagagactctgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: