Login to display prices
Login to display prices
SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene View larger

SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene

PTXBC012603

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene

Proteogenix catalog: PTXBC012603
Ncbi symbol: SDHD
Product name: SDHD-succinate dehydrogenase complex, subunit D, integral membrane protein Gene
Size: 2ug
Accessions: BC012603
Gene id: 6392
Gene description: succinate dehydrogenase complex, subunit D, integral membrane protein
Synonyms: CBT1; CII-4; CWS3; PGL; PGL1; QPs3; SDH4; cybS; succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial; succinate dehydrogenase complex subunit D integral membrane protein; succinate-ubiquinone oxidoreductase cytochrome b small subunit; succinate-ubiquinone reductase membrane anchor subunit; succinate dehydrogenase complex subunit D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggttctctggaggctgagtgccgtttgcggtgccctaggaggccgagctctgttgcttcgaactccagtggtcagacctgctcatatctcagcatttcttcaggaccgacctatcccagaatggtgtggagtgcagcacatacacttgtcaccgagccaccattctggctccaaggctgcatctctccactggactagtgagagggttgtcagtgttttgctcctgggtctgcttccggctgcttatttgaatccttgctctgcgatggactattccctggctgcagccctcactcttcatggtcactggggccttggacaagttgttactgactatgttcatggggatgccttgcagaaagctgccaaggcagggcttttggcactttcagctttaacctttgctgggctttgctatttcaactatcacgatgtgggcatctgcaaagctgttgccatgctgtggaagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice