Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ID2-inhibitor of DNA binding 2, dominant negative helix-loop-helix protein Gene
PTXBC030639
New product
Data sheet of ID2-inhibitor of DNA binding 2, dominant negative helix-loop-helix protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ID2-inhibitor of DNA binding 2, dominant negative helix-loop-helix protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030639 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ID2 |
| Origin species: | Human |
| Product name: | ID2-inhibitor of DNA binding 2, dominant negative helix-loop-helix protein Gene |
| Size: | 2ug |
| Accessions: | BC030639 |
| Gene id: | 3398 |
| Gene description: | inhibitor of DNA binding 2, dominant negative helix-loop-helix protein |
| Synonyms: | helix-loop-helix protein ID2; DNA-binding protein inhibitor ID2; GIG8; ID2A; ID2H; bHLHb26; DNA-binding protein inhibitor ID-2; cell growth-inhibiting gene 8; class B basic helix-loop-helix protein 26; inhibitor of DNA binding 2, dominant negative helix-loop-helix protein; inhibitor of differentiation 2; inhibitor of DNA binding 2, HLH protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagccttcagtcccgtgaggtccgttaggaaaaacagcctgtcggaccacagcctgggcatctcccggagcaaaacccctgtggacgacccgatgagcctgctatacaacatgaacgactgctactccaagctcaaggagctggtgcccagcatcccccagaacaagaaggtgagcaagatggaaatcctgcagcacgtcatcgactacatcttggacctgcagatcgccctggactcgcatcccactattgtcagcctgcatcaccagagacccgggcagaaccaggcgtccaggacgccgctgaccaccctcaacacggatatcagcatcctgtccttgcaggcttctgaattcccttctgagttaatgtcaaatgacagcaaagcactgtgtggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - succinate dehydrogenase complex, subunit D, integral membrane protein - RNA binding motif protein, Y-linked, family 2, member F pseudogene - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) - VAMP (vesicle-associated membrane protein)-associated protein B and C |