SPEG-SPEG complex locus Gene View larger

SPEG-SPEG complex locus Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPEG-SPEG complex locus Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPEG-SPEG complex locus Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006346
Product type: DNA & cDNA
Ncbi symbol: SPEG
Origin species: Human
Product name: SPEG-SPEG complex locus Gene
Size: 2ug
Accessions: BC006346
Gene id: 10290
Gene description: SPEG complex locus
Synonyms: SPEG complex locus; APEG-1; APEG1; BPEG; CNM5; SPEGalpha; SPEGbeta; striated muscle preferentially expressed protein kinase; aortic preferentially expressed gene 1; aortic preferentially expressed protein 1; nuclear protein, marker for differentiated aortic smooth muscle and down-regulated with vascular injury
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcccagtcccagccagaaccgccgttcttctgacactggctccaaggcaccccccaccttcaaggtctcacttatggaccagtcagtaagagaaggccaagatgtcatcatgagcatccgcgtgcagggggagcccaagcctgtggtctcctggctgagaaaccgccagcccgtgcgcccagaccagcggcgctttgcggaggaggctgagggtgggctgtgccggctgcggatcctggctgcagagcgtggcgatgctggtttctacacttgcaaagcggtcaatgagtatggtgctcggcagtgcgaggcccgcttggaggtccgaggcgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 32
- myelin protein zero
- testis expressed 2
- F-box protein 17

Buy SPEG-SPEG complex locus Gene now

Add to cart