FBXO17-F-box protein 17 Gene View larger

FBXO17-F-box protein 17 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBXO17-F-box protein 17 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FBXO17-F-box protein 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012385
Product type: DNA & cDNA
Ncbi symbol: FBXO17
Origin species: Human
Product name: FBXO17-F-box protein 17 Gene
Size: 2ug
Accessions: BC012385
Gene id: 115290
Gene description: F-box protein 17
Synonyms: FBG4; FBX26; FBXO26; Fbx17; F-box only protein 17; F-box only protein 26; F-box protein FBG4; F-box protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgcccggctatcgcggcgacggctgccggcggacccgtccctggccctggacgcgctgcccccggagctgctggtgcaggtgctgagccacgtgccgccacgctccttggtcacgcgatgccgcccagtgtgccgcgcctggcgcgacatagtggacgggcccactgtgtggctgctgcagctggcccgcgaccgcagcgccgagggccgcgcactctacgcagtggctcaacgctgcctgcccagcaacgaagacaaggaggagttcccgctgtgcgccctggcgcgctactgtctgcgcgcgcccttcggccgcaatctcatcttcaactcctgcggagagcagggcttcagaggctgggaggtggagcatggcgggaacggctgggccatagaaaagaacctaacaccggtgcctggggctccttcgcagacctgcttcgtgacctctttcgaatggtgctccaagaggcagcttgtggacctggtgatggaaggggtgtggcaggagctgctggacagcgcccagattgagatctgtgtggctgactggtggggcgctcgagagaactgcggctgcgtctaccagctccgggtccgccttctggatgtgtatgaaaaggaagtggtcaagttctcagcctcacctgacccggtccttcagtggactgagaggggctgccgacaggtctcccacgtcttcaccaactttggcaagggcatccgctacgtatcttttgagcagtacgggagagacgtgagttcctgggtggggcactacggcgcccttgtgacccactccagtgtgagggtcaggatccgtctgtcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 37kDa
- ISL LIM homeobox 1
- adenosine deaminase
- F-box protein 28

Buy FBXO17-F-box protein 17 Gene now

Add to cart