Login to display prices
Login to display prices
FBXO17-F-box protein 17 Gene View larger

FBXO17-F-box protein 17 Gene

PTXBC012385

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBXO17-F-box protein 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FBXO17-F-box protein 17 Gene

Proteogenix catalog: PTXBC012385
Ncbi symbol: FBXO17
Product name: FBXO17-F-box protein 17 Gene
Size: 2ug
Accessions: BC012385
Gene id: 115290
Gene description: F-box protein 17
Synonyms: FBG4; FBX26; FBXO26; Fbx17; F-box only protein 17; F-box only protein 26; F-box protein FBG4; F-box protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgcccggctatcgcggcgacggctgccggcggacccgtccctggccctggacgcgctgcccccggagctgctggtgcaggtgctgagccacgtgccgccacgctccttggtcacgcgatgccgcccagtgtgccgcgcctggcgcgacatagtggacgggcccactgtgtggctgctgcagctggcccgcgaccgcagcgccgagggccgcgcactctacgcagtggctcaacgctgcctgcccagcaacgaagacaaggaggagttcccgctgtgcgccctggcgcgctactgtctgcgcgcgcccttcggccgcaatctcatcttcaactcctgcggagagcagggcttcagaggctgggaggtggagcatggcgggaacggctgggccatagaaaagaacctaacaccggtgcctggggctccttcgcagacctgcttcgtgacctctttcgaatggtgctccaagaggcagcttgtggacctggtgatggaaggggtgtggcaggagctgctggacagcgcccagattgagatctgtgtggctgactggtggggcgctcgagagaactgcggctgcgtctaccagctccgggtccgccttctggatgtgtatgaaaaggaagtggtcaagttctcagcctcacctgacccggtccttcagtggactgagaggggctgccgacaggtctcccacgtcttcaccaactttggcaagggcatccgctacgtatcttttgagcagtacgggagagacgtgagttcctgggtggggcactacggcgcccttgtgacccactccagtgtgagggtcaggatccgtctgtcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: