NUP37-nucleoporin 37kDa Gene View larger

NUP37-nucleoporin 37kDa Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUP37-nucleoporin 37kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUP37-nucleoporin 37kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000861
Product type: DNA & cDNA
Ncbi symbol: NUP37
Origin species: Human
Product name: NUP37-nucleoporin 37kDa Gene
Size: 2ug
Accessions: BC000861
Gene id: 79023
Gene description: nucleoporin 37kDa
Synonyms: nup107-160 subcomplex subunit Nup37; nucleoporin Nup37; p37; nucleoporin 37kDa; nucleoporin 37
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcaagatgcctcaagaaatgctgcctacactgtggattgtgaagattatgtgcatgtggtagaatttaatccctttgagaatggggattcaggaaacctaattgcatatggtggcaataattatgtggtcattggcacgtgtacgtttcaggaagaagaagcagacgttgaaggcattcagtataaaacacttcgaacatttcaccatggagtcagggttgatggcatagcttggagcccagagactagacttgattcattgcctccagtaatcaaattttgtacttcagctgctgatatgaaaattagattatttacttcagatcttcaggataaaaatgaatataaggttttagagggccataccgatttcattaatggtttggtgtttgatcccaaagaaggccaagaaattgcaagtgtgagtgacgatcacacctgcaggatttggaacttggaaggagtgcaaacagctcattttgttcttcattctcctggcatgagtgtgtgctggcatcctgaggagacttttaagctaatggttgcagagaagaatggaacaatccggttttatgatcttttggcccaacaggctattttatctcttgaatcagaacaagtgccattaatgtcagcacactggtgcttaaaaaacaccttcaaagttggagccgttgcaggaaatgattggttaatttgggatattactcggtccagttatcctcaaaataagagacctgttcacatggatcgagcctgcttattcaggtggtccacaattagtgaaaatctgtttgcaaccactggttatcctggcaaaatggcaagccagtttcaaattcatcatttaggacaccctcagcccatcctcatgggttctgtagccgttggatctggactgtcctggcatcgaactctccctctgtgtgtaattggaggagaccacaagctgttgttttgggtgactgaagtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ISL LIM homeobox 1
- adenosine deaminase
- F-box protein 28
- FCH domain only 2

Buy NUP37-nucleoporin 37kDa Gene now

Add to cart