FBXO32-F-box protein 32 Gene View larger

FBXO32-F-box protein 32 Gene

PTXBC024030

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBXO32-F-box protein 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FBXO32-F-box protein 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024030
Product type: DNA & cDNA
Ncbi symbol: FBXO32
Origin species: Human
Product name: FBXO32-F-box protein 32 Gene
Size: 2ug
Accessions: BC024030
Gene id: 114907
Gene description: F-box protein 32
Synonyms: Fbx32; MAFbx; F-box only protein 32; atrogin 1; muscle atrophy F-box protein; F-box protein 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatattttggaaaaagtggtactgaaagtccttgaagaccagcaaaacattagactaataagggaactactccagaccctctacacatccttatgtacactggtccaaagagtcggcaagtctgtgctggtcgggaacattaacatgtgggtgtatcggatggagacgattctccactggcagcagcagctgaacaacattcagatcaccaggcctgccttcaaaggcctcaccttcactgacctgcctttgtgcctacaactgaacatcatgcagaggctgagcgacgggcgggacctggtcagcctgggccaggctgcccccgacctgcacgtgctcagcgaagaccggctgctgtggaagaaactctgccagtaccacttctccgagcggcagatccgcaaacgattaattctgtcagacaaagggcagctggattggaagaagatgtatttcaaactcgtccgatgttacccaaggaaagagcagtatggagatacccttcagctccgcaaacactgtcacatcctttcctggaagggcactgaccatccgtgcactgccaataacccagagagctgctccgtttcactttcaccccaggactttatcaacttgttcaagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myelin protein zero
- testis expressed 2
- F-box protein 17
- nucleoporin 37kDa

Buy FBXO32-F-box protein 32 Gene now

Add to cart