MPZ-myelin protein zero Gene View larger

MPZ-myelin protein zero Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPZ-myelin protein zero Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MPZ-myelin protein zero Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006491
Product type: DNA & cDNA
Ncbi symbol: MPZ
Origin species: Human
Product name: MPZ-myelin protein zero Gene
Size: 2ug
Accessions: BC006491
Gene id: 4359
Gene description: myelin protein zero
Synonyms: CHM; CMT1; CMT1B; CMT2I; CMT2J; CMT4E; CMTDI3; CMTDID; DSS; HMSNIB; MPP; myelin protein P0; Charcot-Marie-Tooth neuropathy 1B; myelin peripheral protein; myelin protein zero
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccgggcccctgcccctgccccagctatggctcctggggctccctcatccagccccagccctatcctggctgtgctgctcttctcttctttggtgctgtccccggcccaggccatcgtggtttacaccgacagggaggtccatggtgctgtgggctcccgggtgaccctgcactgctccttctggtccagtgagtgggtctcagatgacatctccttcacctggcgctaccagcccgaagggggcagagatgccatttcgatcttccactatgccaagggacaaccctacattgacgaggtggggaccttcaaagagcgcatccagtgggtaggggaccctcgctggaaggatggctccattgtcatacacaacctagactacagtgacaatggcacgttcacttgtgacgtcaaaaaccctccagacatagtgggcaagacctctcaggtcacgctgtatgtctttgaaaaagtgccaactaggtacggggtcgttctgggagctgtgatcgggggtgtcctcggggtggtgctgttgctgctgctgcttttctacgtggttcggtactgctggctacgcaggcaggcggccctgcagaggaggctcagtgctatggagaaggggaaattgcacaagccaggaaaggacgcgtcgaagcgcgggcggcagacgccagtgctgtatgcaatgctggaccacagcagaagcaccaaagctgtcagtgagaagaaggccaaggggctgggggagtctcgcaaggataagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - testis expressed 2
- F-box protein 17
- nucleoporin 37kDa
- ISL LIM homeobox 1

Buy MPZ-myelin protein zero Gene now

Add to cart