TEX2-testis expressed 2 Gene View larger

TEX2-testis expressed 2 Gene

PTXBC033661

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TEX2-testis expressed 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TEX2-testis expressed 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033661
Product type: DNA & cDNA
Ncbi symbol: TEX2
Origin species: Human
Product name: TEX2-testis expressed 2 Gene
Size: 2ug
Accessions: BC033661
Gene id: 55852
Gene description: testis expressed 2
Synonyms: HT008; TMEM96; testis-expressed sequence 2 protein; testis expressed sequence 2; transmembrane protein 96; testis expressed 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaactcagcaaaataaagctcccctactttatgaatgagctcactctgacggaacttgacatgggcgtggctgtgccaaaaatcctccaggccttcaagccttacgttgatcaccaaggactctggattgatttggaaatgtcctacaatgggtcctttctgatgactctcgagaccaaaatgaatttgaccaaactaggtaaagagcctcttgttgaagccctgaaggttggagaaattggcaaagaaggttgcaggccccgggcattctgtctggcggacagcgatgaggaatcctccagcgctggctcctccgaggaagacgatgccccagagcccagcgggggagacaaacagctcctcccaggggctgaagggtacgttggaggtcatcgaacaagtaagattatgaggtttgttgataaaattaccaagtcaaaatatttccaaaaagcaacagagacagagtttattaaaaagaagatcgaagaagtctccaacacacccctgctgctcactgttgaagtacaagaatgtagaggaaccttggcggtcaacattccaccacccccgactgaccgagtatggtatggtttccgaaagccaccacatgtggagctgaaagctcggccaaaacttggagagagagaagtgactttagttcatgtgacagactggatagagaagaaactggagcaagagtttcagaaagtttttgtcatgccaaacatggatgatgtttatatcactataatgcactcagccatggaccctcgctctacttcctgcctcctgaaagacccacctgtggaggctgctgatcagccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 17
- nucleoporin 37kDa
- ISL LIM homeobox 1
- adenosine deaminase

Buy TEX2-testis expressed 2 Gene now

Add to cart