KIAA0101-KIAA0101 Gene View larger

KIAA0101-KIAA0101 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIAA0101-KIAA0101 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KIAA0101-KIAA0101 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005832
Product type: DNA & cDNA
Ncbi symbol: KIAA0101
Origin species: Human
Product name: KIAA0101-KIAA0101 Gene
Size: 2ug
Accessions: BC005832
Gene id: 9768
Gene description: KIAA0101
Synonyms: KIAA0101; NS5ATP9; OEATC; OEATC-1; OEATC1; PAF; PAF15; p15(PAF); p15/PAF; p15PAF; PCNA-associated factor; HCV NS5A-transactivated protein 9; PCNA-associated factor of 15 kDa; hepatitis C virus NS5A-transactivated protein 9; overexpressed in anaplastic thyroid carcinoma 1; PCNA clamp associated factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggactaaagcagacagtgttccaggcacttacagaaaagtggtggctgctcgagcccccagaaaggtgcttggttcttccacctctgccactaattcgacatcagtttcatcgaggaaagctgaaaataaatatgcaggagggaaccccgtttgcgtgcgcccaactcccaagtggcaaaaaggaattggagaattctttaggttgtcccctaaagattctgaaaaagagaatcagattcctgaagaggcaggaagcagtggcttaggaaaagcaaagagaaaagcatgtcctttgcaacctgatcacacaaatgatgaaaaagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G antigen 5
- transthyretin
- KIAA1143
- complexin 3

Buy KIAA0101-KIAA0101 Gene now

Add to cart