SIVA1-SIVA1, apoptosis-inducing factor Gene View larger

SIVA1-SIVA1, apoptosis-inducing factor Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIVA1-SIVA1, apoptosis-inducing factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SIVA1-SIVA1, apoptosis-inducing factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034562
Product type: DNA & cDNA
Ncbi symbol: SIVA1
Origin species: Human
Product name: SIVA1-SIVA1, apoptosis-inducing factor Gene
Size: 2ug
Accessions: BC034562
Gene id: 10572
Gene description: SIVA1, apoptosis-inducing factor
Synonyms: SIVA1 apoptosis inducing factor; CD27BP; SIVA; Siva-1; Siva-2; apoptosis regulatory protein Siva; CD27-binding (Siva) protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaagcggagctgccccttcgcggacgtggccccgctacagctcaaggtccgcgtgagccagagggagttgagccgcggcgtgtgcgccgagcgctactcgcaggaggtcttcgacccatctggggtagcgtccattgcctgttcctcatgcgtgcgagccgtggatgggaaggcggtctgcggtcagtgtgagcgagccctgtgcgggcagtgtgtgcgcacctgctggggctgcggctccgtggcctgtaccctgtgtggcctcgtggactgcagtgacatgtacgagaaagtgctgtgcaccagctgtgccatgttcgagacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) ligand 5
- WAP four-disulfide core domain 5
- RAD51 homolog C (S. cerevisiae)
- hypothetical protein FLJ14107

Buy SIVA1-SIVA1, apoptosis-inducing factor Gene now

Add to cart