Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SIVA1-SIVA1, apoptosis-inducing factor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SIVA1-SIVA1, apoptosis-inducing factor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034562 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIVA1 |
| Origin species: | Human |
| Product name: | SIVA1-SIVA1, apoptosis-inducing factor Gene |
| Size: | 2ug |
| Accessions: | BC034562 |
| Gene id: | 10572 |
| Gene description: | SIVA1, apoptosis-inducing factor |
| Synonyms: | SIVA1 apoptosis inducing factor; CD27BP; SIVA; Siva-1; Siva-2; apoptosis regulatory protein Siva; CD27-binding (Siva) protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccaagcggagctgccccttcgcggacgtggccccgctacagctcaaggtccgcgtgagccagagggagttgagccgcggcgtgtgcgccgagcgctactcgcaggaggtcttcgacccatctggggtagcgtccattgcctgttcctcatgcgtgcgagccgtggatgggaaggcggtctgcggtcagtgtgagcgagccctgtgcgggcagtgtgtgcgcacctgctggggctgcggctccgtggcctgtaccctgtgtggcctcgtggactgcagtgacatgtacgagaaagtgctgtgcaccagctgtgccatgttcgagacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-X-C motif) ligand 5 - WAP four-disulfide core domain 5 - RAD51 homolog C (S. cerevisiae) - hypothetical protein FLJ14107 |