CXCL2-chemokine (C-X-C motif) ligand 2 Gene View larger

CXCL2-chemokine (C-X-C motif) ligand 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL2-chemokine (C-X-C motif) ligand 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL2-chemokine (C-X-C motif) ligand 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015753
Product type: DNA & cDNA
Ncbi symbol: CXCL2
Origin species: Human
Product name: CXCL2-chemokine (C-X-C motif) ligand 2 Gene
Size: 2ug
Accessions: BC015753
Gene id: 2920
Gene description: chemokine (C-X-C motif) ligand 2
Synonyms: CINC-2a; GRO2; GROb; MGSA-b; MIP-2a; MIP2; MIP2A; SCYB2; C-X-C motif chemokine 2; GRO2 oncogene; MGSA beta; MIP2-alpha; chemokine (C-X-C motif) ligand 2; gro-beta; growth-regulated protein beta; macrophage inflammatory protein 2-alpha; melanoma growth stimulatory activity beta; C-X-C motif chemokine ligand 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgcgccacgctctccgccgcccccagcaatccccggctcctgcgggtggcgctgctgctcctgctcctggtggccgccagccggcgcgcagcaggagcgcccctggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcacctcaagaacatccaaagtgtgaaggtgaagtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggcagaaagcttgtctcaaccccgcatcgcccatggttaagaaaatcatcgaaaagatgctgaaaaatggcaaatccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SIVA1, apoptosis-inducing factor
- chemokine (C-X-C motif) ligand 5
- WAP four-disulfide core domain 5
- RAD51 homolog C (S. cerevisiae)

Buy CXCL2-chemokine (C-X-C motif) ligand 2 Gene now

Add to cart