Login to display prices
Login to display prices
CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene View larger

CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009792
Product type: DNA & cDNA
Ncbi symbol: CSTF3
Origin species: Human
Product name: CSTF3-cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa Gene
Size: 2ug
Accessions: BC009792
Gene id: 1479
Gene description: cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Synonyms: CSTF-77; cleavage stimulation factor subunit 3; CF-1 77 kDa subunit; CSTF 77 kDa subunit; cleavage stimulation factor 77 kDa subunit; cleavage stimulation factor, 3' pre-RNA, subunit 3; cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD; cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggagacggagccacggagcaggcagctgagtatgtcccagagaaggtgaagaaagcggaaaagaaattagaagagaatccatatgaccttgatgcttggagcattctcattcgagaggcacagaatcaacctatagacaaagcacggaagacttatgaacgccttgttgcccagttccccagttctggcagattctggaaactgtacattgaagcagaggttactattttattttattttttcttatatcagtattgcagcattcactgtagtgatagaaaacaagttaggaacatagccaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipase A2, group IIA (platelets, synovial fluid)
- tumor necrosis factor, alpha-induced protein 8-like 1
- cysteine and glycine-rich protein 3 (cardiac LIM protein)
- chorionic somatomammotropin hormone 1 (placental lactogen)