TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene View larger

TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017672
Product type: DNA & cDNA
Ncbi symbol: TNFAIP8L1
Origin species: Human
Product name: TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene
Size: 2ug
Accessions: BC017672
Gene id: 126282
Gene description: tumor necrosis factor, alpha-induced protein 8-like 1
Synonyms: TIPE1; tumor necrosis factor alpha-induced protein 8-like protein 1; TNF alpha-induced protein 8-like protein 1; TNFAIP8-like protein 1; oxidative stress-regulated gene-beta; oxy-beta; tumor necrosis factor, alpha induced protein 8 like 1; tumor necrosis factor, alpha-induced protein 8-like protein 1; TNF alpha induced protein 8 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaccttcagcaccaagagcctggctctgcaggcgcagaagaagctcctgagtaagatggcgtccaaggcagtggtggccgtgctggtggatgacaccagcagtgaggtgctggatgagctgtaccgcgccaccagggagttcacgcgcagccgcaaggaggcccagaagatgctcaagaacctggtcaaggtggccctgaagctgggactgctgctgcgtggggaccagctgggcggtgaggagctggcgctgctgcggcgcttccgccaccgggcgcgctgcctggccatgacggccgtcagcttccaccaggtggacttcaccttcgaccggcgcgtgctggccgtcgggctgctcgagtgccgcgacctgctgcaccaggccgtgggtccccacctgaccgccaagtcccacggccgcatcaaccacgtgttcggccacctagccgactgcgacttcctggctgcgctctacggccccgccgagccctaccgctcccacctgcgcaggatctgcgagggcctgggccggatgctggacgagggcagcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine and glycine-rich protein 3 (cardiac LIM protein)
- chorionic somatomammotropin hormone 1 (placental lactogen)
- transmembrane emp24 protein transport domain containing 5
- leucine zipper-EF-hand containing transmembrane protein 2

Buy TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene now

Add to cart