CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene View larger

CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene

PTXBC002717

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002717
Product type: DNA & cDNA
Ncbi symbol: CSH1
Origin species: Human
Product name: CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene
Size: 2ug
Accessions: BC002717
Gene id: 1442
Gene description: chorionic somatomammotropin hormone 1 (placental lactogen)
Synonyms: CS-1; CSA; CSMT; GHB3; hCS-1; hCS-A; chorionic somatomammotropin hormone 1; choriomammotropin; chorionic somatomammotropin A; chorionic somatomammotropin-1; growth hormone B3; placental lactogen
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccaggctcccggacgtccctgctcctggcttttgccctgctctgcctgccctggcttcaagaggctggtgccgtccaaaccgttccgttatccaggctttttgaccacgctatgctccaagcccatcgcgcgcaccagctggccattgacacctaccaggagtttgaagaaacctatatcccaaaggaccagaagtattcattcctgcatgactcccagacctccttctgcttctcagactctattccgacaccctccaacatggaggaaacgcaacagaaatccaatctagagctgctccgcatctccctgctgctcatcgagtcgtggctggagcccgtgcggttcctcaggagtatgttcgccaacaacctggtgtatgacacctcggacagcgatgactatcacctcctaaaggacctagaggaaggcatccaaacgctgatggggaggctggaagacggcagccgccggactgggcagatcctcaagcagacctacagcaagtttgacacaaactcgcacaaccatgacgcactgctcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgagacattcctgcgcatggtgcagtgccgctctgtggagggcagctgtggcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane emp24 protein transport domain containing 5
- leucine zipper-EF-hand containing transmembrane protein 2
- major histocompatibility complex, class II, DQ alpha 1
- major histocompatibility complex, class II, DP alpha 1

Buy CSH1-chorionic somatomammotropin hormone 1 (placental lactogen) Gene now

Add to cart