HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene View larger

HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene

PTXBC008585

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008585
Product type: DNA & cDNA
Ncbi symbol: HLA-DQA1
Origin species: Human
Product name: HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene
Size: 2ug
Accessions: BC008585
Gene id: 3117
Gene description: major histocompatibility complex, class II, DQ alpha 1
Synonyms: CELIAC1; DQ-A1; HLA-DQA; HLA class II histocompatibility antigen, DQ alpha 1 chain; DC-1 alpha chain; DC-alpha; HLA-DCA; MHC HLA-DQ alpha; MHC class II DQA1; MHC class II HLA-DQ-alpha-1; major histocompatibility complex, class II, DQ alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcctaaacaaagctctgatgctgggggcccttgccctgaccaccgtgatgagcccctgtggaggtgaagacattgtggctgaccacgtcgcctcttatggtgtaaacttgtaccagtcttacggtccctctggccagtacacccatgaatttgatggagatgagcagttctacgtggacctggggaggaaggagactgtctggtgtttgcctgttctcagacaatttagatttgacccgcaatttgcactgacaaacatcgctgtcctaaaacataacttgaacagtctgattaaacgctccaactctaccgctgctaccaatgaggttcctgaggtcacagtgttttccaagtctcccgtgacactgggtcagcccaacatcctcatctgtcttgtggacaacatctttcctcctgtggtcaacatcacatggctgagcaatgggcactcagtcacagaaggtgtttctgagaccagcttcctctccaagagtgatcattccttcttcaagatcagttacctcaccctcctcccttctgctgaggagagttatgactgcaaggtggagcactggggcctggacaagcctcttctgaaacactgggagcctgagattccagcccctatgtcagagctcacagagactgtggtctgcgccctgggattgtctgtgggcctcgtgggcattgtggtgggcactgtcttcatcatccgaggcctgcgttcagttggtgcttccagacaccaagggcccttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DP alpha 1
- tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
- enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
- MKI67 (FHA domain) interacting nucleolar phosphoprotein

Buy HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene now

Add to cart