ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene View larger

ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008906
Product type: DNA & cDNA
Ncbi symbol: ECHS1
Origin species: Human
Product name: ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene
Size: 2ug
Accessions: BC008906
Gene id: 1892
Gene description: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Synonyms: ECHS1D; SCEH; enoyl-CoA hydratase, mitochondrial; enoyl Coenzyme A hydratase, short chain, 1, mitochondrial; enoyl-CoA hydratase, short chain, 1, mitochondrial; short chain enoyl-CoA hydratase; enoyl-CoA hydratase, short chain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgccctgcgtgtcctgctgtcctgcgtccgcggcccgctgaggcccccggttcgctgtcccgcctggcgtcccttcgcctcgggtgctaactttgagtacatcatcgcagaaaaaagagggaagaataacaccgtggggttgatccaactgaaccgccccaaggccctcaatgcactttgcgatggcctgattgacgagctcaaccaggccctgaagatcttcgaggaggacccggccgtgggggccattgtcctcaccggcggggataaggcctttgcagctggagctgatatcaaggaaatgcagaacctgagtttccaggactgttactccagcaagttcttgaagcactgggaccacctcacccaggtcaagaagccagtcatcgctgctgtcaatggctatgcctttggcgggggctgtgagcttgccatgatgtgtgatatcatctatgccggtgagaaggcccagtttgcacagccggagatcttaataggaaccatcccaggtgcgggcggcacccagagactcacccgtgctgttgggaagtcgctggcgatggagatggtcctcaccggtgaccggatctcagcccaggacgccaagcaagcaggtcttgtcagcaagatttgtcctgttgagacactggtggaagaagccatccagtgtgcagaaaaaattgccagcaattctaaaattgtagtagcgatggccaaagaatcagtgaatgcagcttttgaaatgacattaacagaaggaagtaagttggagaagaaactcttttattcaacctttgccactgatgaccggaaagaagggatgaccgcgtttgtggaaaagagaaaggccaacttcaaagaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MKI67 (FHA domain) interacting nucleolar phosphoprotein
- ceroid-lipofuscinosis, neuronal 6, late infantile, variant
- solute carrier family 39 (zinc transporter), member 13
- carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4

Buy ECHS1-enoyl Coenzyme A hydratase, short chain, 1, mitochondrial Gene now

Add to cart