HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene View larger

HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009956
Product type: DNA & cDNA
Ncbi symbol: HLA-DPA1
Origin species: Human
Product name: HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene
Size: 2ug
Accessions: BC009956
Gene id: 3113
Gene description: major histocompatibility complex, class II, DP alpha 1
Synonyms: MHC class II HLA-DPA1 antigen; DP(W3); DP(W4); HLA-DP1A; HLADP; HLASB; PLT1; HLA class II histocompatibility antigen, DP alpha 1 chain; HLA-SB alpha chain; MHC class II DP3-alpha; major histocompatibility complex, class II, DP alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgccctgaagacagaatgttccatatcagagctgtgatcttgagagccctctccttggctttcctgctgagtctccgaggagctggggccatcaaggcggaccatgtgtcaacttatgccgcgtttgtacagacccatagaccaacaggggagtttatgtttgaatttgatgaagatgagcagttctatgtggatctggataaaaaggagaccgtctggcatctggaggagtttggccgagccttttcctttgaggctcagggcgggctggctaacattgctatattgaacaacaacttgaataccttgatccagcgttccaaccacactcaggccgccaatgatccccctgaggtgaccgtgtttcccaaggagcctgtggagctgggccagcccaacaccctcatctgccacattgacaggttcttcccaccagtgctcaacgtcacatggctgtgcaatggggagccagtcactgagggtgtcgctgagagcctcttcctgcccagaacagattacagcttccacaagttccattacctgacctttgtgccctcagcagaggacgtctatgactgcagggtggagcactggggcttggaccagccgctcctcaagcactgggaggcccaagagccaatccagatgcctgagacaacggagactgtgctctgtgccctgggcctggtgctgggcctagtgggcatcatcgtgggcaccgtcctcatcataaagtctctgcgttctggccatgacccccgggcccaggggcccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
- enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
- MKI67 (FHA domain) interacting nucleolar phosphoprotein
- ceroid-lipofuscinosis, neuronal 6, late infantile, variant

Buy HLA-DPA1-major histocompatibility complex, class II, DP alpha 1 Gene now

Add to cart