Cart 2 Product Products 482,40 € (empty)
-
1 x SLN-sarcol...113,40 € -
No products
To be determined Shipping
482,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 482,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 482,40 €
View larger 
THG1L-tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) Gene
PTXBC001523
New product
Data sheet of THG1L-tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about THG1L-tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001523 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | THG1L |
| Origin species: | Human |
| Product name: | THG1L-tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001523 |
| Gene id: | 54974 |
| Gene description: | tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) |
| Synonyms: | IHG-1; hTHG1; induced by high glucose-1; interphase cytoplasmic foci protein 45; tRNA-histidine guanylyltransferase 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaaaagcaagttcgagtacgtgagggacttcgaggctgacgacacctgcctggcacactgctgggtggtagtgcggctggacggccggaatttccatcggtttgctgagaagcacaactttgcaaaacccaatgacagccgtgctctccagctgatgaccaaatgtgcgcagactgtgatggaagaactagaggatattgtgatcgcgtatggacagagtgatgagtacagctttgtgttcaagcggaaaaccaattggtttaaaagaagagccagtaagttcatgactcacgtggcctcccagtttgcctccagctatgtgttttattggcgggattactttgaggaccagccccttctgtatcccccaggctttgacggaagagtcgtggtgtatcccagcaaccagactttaaaggactacctcagctggcgacaagcagattgtcacatcaataatctttataatacagttttctgggcacttatacaacaatctggactaacaccagtacaagcccaagggagattacagggaactcttgcagcagacaagaatgagattttgttttctgaattcaacatcaactataataatgagctgccgatgtataggaaagggactgtgttgatatggcagaaggtggatgaagtgatgacaaaagaaattaagctgccaacagaaatggaaggaaaaaagatggcagtgacccggaccaggacaaagccagtgcccttgcactgcgatatcatcggggatgctttctggaaggaacatccagagattctagatgaagacagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - enoyl Coenzyme A hydratase, short chain, 1, mitochondrial - MKI67 (FHA domain) interacting nucleolar phosphoprotein - ceroid-lipofuscinosis, neuronal 6, late infantile, variant - solute carrier family 39 (zinc transporter), member 13 |