No products
Prices are tax excluded
PTXBC029541
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029541 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LETM2 |
| Origin species: | Human |
| Product name: | LETM2-leucine zipper-EF-hand containing transmembrane protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC029541 |
| Gene id: | 137994 |
| Gene description: | leucine zipper-EF-hand containing transmembrane protein 2 |
| Synonyms: | LETM1 domain-containing protein LETM2, mitochondrial; LETM1 and EF-hand domain-containing protein 2; leucine zipper-EF-hand containing transmembrane protein 1-like protein; leucine zipper-EF-hand containing transmembrane protein 2; leucine zipper and EF-hand containing transmembrane protein 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgatgcctctacacagctctcatcctacgtgaagcaggtccagacaggccacaagcccagcacaaaggagatagttcgcttctccaaactatttgaggaccagctggccctggaacacttagatcgccctcagctggttgccctttgcaaactgctggaattgcagacatttggaaccaacaacctgctccgctttcagctcctgatgaaactgaagtctataaaagcagatgatgaaataattgccaaggaaggggtgacagcattgagtgtatcagaactacaggctgcctgtagggcccgagggatgagatcactgggtctcacggaggaacaactgcgacaacagctcacggagtggcaggacctccacctgaaggagaacgtccctccttcccttttgctcctgtcccgcaccttctacctgatagatgtgaagcccaagccgattgagataccactcagtggggaggctccaaagactgatattcttgtggaattacctactttcactgaatctaaagagaacatggtggatcttgcacctcaactgaagggaactaaggatgaagactttatacagccgccaccagttacatcatcacccataacaccatcaacacctatttcattacctaaaggacccatcacttcttctgaagaacctacactccaggccaaatcacaaatgacggcccagaacagcaaggctagttcaaaaggagcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DQ alpha 1 - major histocompatibility complex, class II, DP alpha 1 - tRNA-histidine guanylyltransferase 1-like (S. cerevisiae) - enoyl Coenzyme A hydratase, short chain, 1, mitochondrial |