Login to display prices
Login to display prices
CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene View larger

CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene

PTXBC024010

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene

Proteogenix catalog: PTXBC024010
Ncbi symbol: CSRP3
Product name: CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene
Size: 2ug
Accessions: BC024010
Gene id: 8048
Gene description: cysteine and glycine-rich protein 3 (cardiac LIM protein)
Synonyms: CLP; CMD1M; CMH12; CRP3; LMO4; MLP; cysteine and glycine-rich protein 3; LIM domain only 4; cardiac LIM domain protein; cysteine and glycine-rich protein 3 (cardiac LIM protein); muscle lim protein isoform; cysteine and glycine rich protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaactggggcggaggcgcaaaatgtggagcctgtgaaaagaccgtctaccatgcagaagaaatccagtgcaatggaaggagtttccacaagacgtgtttccactgcatggcctgcaggaaggctcttgacagcacgacagtcgcggctcatgagtcggagatctactgcaaggtgtgctatgggcgcagatatggccccaaagggatcgggtatggacaaggcgctggctgtctcagcacagacacgggcgagcatctcggcctgcagttccaacagtccccaaagccggcacgctcagttaccaccagcaacccttccaaattcactgcgaagtttggagagtccgagaagtgccctcgatgtggcaagtcagtctatgctgctgagaaggttatgggaggtggcaagccttggcacaagacctgtttccgctgtgccatctgtgggaagagtctggagtccacaaatgtcactgacaaagatggggaactttattgcaaagtttgctatgccaaaaattttggccccacgggtattgggtttggaggccttacacaacaagtggaaaagaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice