Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene
PTXBC024010
New product
Data sheet of CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024010 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CSRP3 |
| Origin species: | Human |
| Product name: | CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene |
| Size: | 2ug |
| Accessions: | BC024010 |
| Gene id: | 8048 |
| Gene description: | cysteine and glycine-rich protein 3 (cardiac LIM protein) |
| Synonyms: | CLP; CMD1M; CMH12; CRP3; LMO4; MLP; cysteine and glycine-rich protein 3; LIM domain only 4; cardiac LIM domain protein; cysteine and glycine-rich protein 3 (cardiac LIM protein); muscle lim protein isoform; cysteine and glycine rich protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaaactggggcggaggcgcaaaatgtggagcctgtgaaaagaccgtctaccatgcagaagaaatccagtgcaatggaaggagtttccacaagacgtgtttccactgcatggcctgcaggaaggctcttgacagcacgacagtcgcggctcatgagtcggagatctactgcaaggtgtgctatgggcgcagatatggccccaaagggatcgggtatggacaaggcgctggctgtctcagcacagacacgggcgagcatctcggcctgcagttccaacagtccccaaagccggcacgctcagttaccaccagcaacccttccaaattcactgcgaagtttggagagtccgagaagtgccctcgatgtggcaagtcagtctatgctgctgagaaggttatgggaggtggcaagccttggcacaagacctgtttccgctgtgccatctgtgggaagagtctggagtccacaaatgtcactgacaaagatggggaactttattgcaaagtttgctatgccaaaaattttggccccacgggtattgggtttggaggccttacacaacaagtggaaaagaaagaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chorionic somatomammotropin hormone 1 (placental lactogen) - transmembrane emp24 protein transport domain containing 5 - leucine zipper-EF-hand containing transmembrane protein 2 - major histocompatibility complex, class II, DQ alpha 1 |