Login to display prices
Login to display prices
CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene View larger

CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024010
Product type: DNA & cDNA
Ncbi symbol: CSRP3
Origin species: Human
Product name: CSRP3-cysteine and glycine-rich protein 3 (cardiac LIM protein) Gene
Size: 2ug
Accessions: BC024010
Gene id: 8048
Gene description: cysteine and glycine-rich protein 3 (cardiac LIM protein)
Synonyms: CLP; CMD1M; CMH12; CRP3; LMO4; MLP; cysteine and glycine-rich protein 3; LIM domain only 4; cardiac LIM domain protein; cysteine and glycine-rich protein 3 (cardiac LIM protein); muscle lim protein isoform; cysteine and glycine rich protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaactggggcggaggcgcaaaatgtggagcctgtgaaaagaccgtctaccatgcagaagaaatccagtgcaatggaaggagtttccacaagacgtgtttccactgcatggcctgcaggaaggctcttgacagcacgacagtcgcggctcatgagtcggagatctactgcaaggtgtgctatgggcgcagatatggccccaaagggatcgggtatggacaaggcgctggctgtctcagcacagacacgggcgagcatctcggcctgcagttccaacagtccccaaagccggcacgctcagttaccaccagcaacccttccaaattcactgcgaagtttggagagtccgagaagtgccctcgatgtggcaagtcagtctatgctgctgagaaggttatgggaggtggcaagccttggcacaagacctgtttccgctgtgccatctgtgggaagagtctggagtccacaaatgtcactgacaaagatggggaactttattgcaaagtttgctatgccaaaaattttggccccacgggtattgggtttggaggccttacacaacaagtggaaaagaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chorionic somatomammotropin hormone 1 (placental lactogen)
- transmembrane emp24 protein transport domain containing 5
- leucine zipper-EF-hand containing transmembrane protein 2
- major histocompatibility complex, class II, DQ alpha 1