Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PLA2G2A-phospholipase A2, group IIA (platelets, synovial fluid) Gene
PTXBC005919
New product
Data sheet of PLA2G2A-phospholipase A2, group IIA (platelets, synovial fluid) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G2A-phospholipase A2, group IIA (platelets, synovial fluid) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005919 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G2A |
| Origin species: | Human |
| Product name: | PLA2G2A-phospholipase A2, group IIA (platelets, synovial fluid) Gene |
| Size: | 2ug |
| Accessions: | BC005919 |
| Gene id: | 5320 |
| Gene description: | phospholipase A2, group IIA (platelets, synovial fluid) |
| Synonyms: | MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2; phospholipase A2, membrane associated; GIIC sPLA2; NPS-PLA2; group IIA phospholipase A2; non-pancreatic secretory phospholipase A2; phosphatidylcholine 2-acylhydrolase 2A; phospholipase A2, group IIA (platelets, synovial fluid); phospholipase A2 group IIA |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaccctcctactgttggcagtgatcatgatctttggcctactgcaggcccatgggaatttggtgaatttccacagaatgatcaagttgacgacaggaaaggaagccgcactcagttatggcttctacggctgccactgtggcgtgggtggcagaggatcccccaaggatgcaacggatcgctgctgtgtcactcatgactgttgctacaaacgtctggagaaacgtggatgtggcaccaaatttctgagctacaagtttagcaactcggggagcagaatcacctgtgcaaaacaggactcctgcagaagtcaactgtgtgagtgtgataaggctgctgccacctgttttgctagaaacaagacgacctacaataaaaagtaccagtactattccaataaacactgcagagggagcacccctcgttgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor, alpha-induced protein 8-like 1 - cysteine and glycine-rich protein 3 (cardiac LIM protein) - chorionic somatomammotropin hormone 1 (placental lactogen) - transmembrane emp24 protein transport domain containing 5 |