Login to display prices
Login to display prices
S100A7-S100 calcium binding protein A7 Gene View larger

S100A7-S100 calcium binding protein A7 Gene

PTXBC034687

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A7-S100 calcium binding protein A7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A7-S100 calcium binding protein A7 Gene

Proteogenix catalog: PTXBC034687
Ncbi symbol: S100A7
Product name: S100A7-S100 calcium binding protein A7 Gene
Size: 2ug
Accessions: BC034687
Gene id: 6278
Gene description: S100 calcium binding protein A7
Synonyms: PSOR1; S100A7c; protein S100-A7; psoriasin 1; S100 calcium binding protein A7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaacactcaagctgagaggtccataataggcatgatcgacatgtttcacaaatacaccagacgtgatgacaagattgacaagccaagcctgctgacgatgatgaaggagaacttccccaacttccttagtgcctgtgacaaaaagggcacaaattacctcgccgatgtctttgagaaaaaggacaagaatgaggataagaagattgatttttctgagtttctgtccttgctgggagacatagccacagactaccacaagcagagccatggagcagcgccctgttccgggggcagccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: