VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene View larger

VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene

PTXBC005941

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005941
Product type: DNA & cDNA
Ncbi symbol: VAMP3
Origin species: Human
Product name: VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene
Size: 2ug
Accessions: BC005941
Gene id: 9341
Gene description: vesicle-associated membrane protein 3 (cellubrevin)
Synonyms: CEB; vesicle-associated membrane protein 3; VAMP-3; cellubrevin; synaptobrevin-3; vesicle associated membrane protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctacaggtccaactgctgccactggcagtaatcgaagacttcagcagacacaaaatcaagtagatgaggtggtggacataatgcgagttaacgtggacaaggttctggaaagagaccagaagctctctgagttagacgaccgtgcagacgcactgcaggcaggcgcttctcaatttgaaacgagcgcagccaagttgaagaggaaatattggtggaagaattgcgagatgtgggcaatcgggattactgttctggttatcttcatcatcatcatcatcgtgtgggttgtctcttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - integrin beta 3 binding protein (beta3-endonexin)
- v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
- cell division cycle 42 (GTP binding protein, 25kDa)
- loss of heterozygosity, 12, chromosomal region 1

Buy VAMP3-vesicle-associated membrane protein 3 (cellubrevin) Gene now

Add to cart