TCEAL7-transcription elongation factor A (SII)-like 7 Gene View larger

TCEAL7-transcription elongation factor A (SII)-like 7 Gene

PTXBC005988

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCEAL7-transcription elongation factor A (SII)-like 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCEAL7-transcription elongation factor A (SII)-like 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005988
Product type: DNA & cDNA
Ncbi symbol: TCEAL7
Origin species: Human
Product name: TCEAL7-transcription elongation factor A (SII)-like 7 Gene
Size: 2ug
Accessions: BC005988
Gene id: 56849
Gene description: transcription elongation factor A (SII)-like 7
Synonyms: MPMGp800C04260Q003; WEX5; transcription elongation factor A protein-like 7; TCEA-like protein 7; transcription elongation factor A (SII)-like 7; transcription elongation factor S-II protein-like 7; transcription elongation factor A like 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaaaaaccctgcaaagaaaacgaaggaaagccaaagtgcagcgtgccaaagagggaggaaaaacgcccgtatggagaatttgaacgccagcaaacagaagggaattttagacagaggctgcttcagtctctcgaagaatttaaagaggacatagactataggcattttaaagatgaagaaatgacaagggagggagatgagatggaaaggtgtttggaagagataaggggtctgagaaagaaatttagggctctgcattctaaccataggcattctcgggaccgtccttatcccatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon, alpha-inducible protein 27-like 1
- cytochrome c oxidase subunit VIa polypeptide 1
- CDKN2A interacting protein N-terminal like
- family with sequence similarity 104, member B

Buy TCEAL7-transcription elongation factor A (SII)-like 7 Gene now

Add to cart