CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene View larger

CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene

PTXBC008293

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008293
Product type: DNA & cDNA
Ncbi symbol: CDKN2AIPNL
Origin species: Human
Product name: CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene
Size: 2ug
Accessions: BC008293
Gene id: 91368
Gene description: CDKN2A interacting protein N-terminal like
Synonyms: CDKN2AIP N-terminal-like protein; CDKN2A-interacting protein N-terminal-like protein; CDKN2A interacting protein N-terminal like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcggtggcgaggcggctgccgcagtggaggagctggtttcgggggtgcggcaggcggccgacttcgcggagcagttccgctcctactcagagagcgagaagcaatggaaggcccgcatggaattcatcctgcgccacctgcccgactaccgcgacccgcccgacggcagtggccgcctggaccagctgctctccctctccatggtctgggccaaccatctcttcctaggctgcagttacaataaagaccttttagacaaggtgatggaaatggccgatgggattgaagtggaagacctgccacaatttactaccagaagtgaattaatgaaaaagcatcaaagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 104, member B
- family with sequence similarity 107, member B
- family with sequence similarity 185, member A
- heat shock protein family B (small), member 11

Buy CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene now

Add to cart