PTXBC017571
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM104B |
| Origin species: | Human |
| Product name: | FAM104B-family with sequence similarity 104, member B Gene |
| Size: | 2ug |
| Accessions: | BC017571 |
| Gene id: | 90736 |
| Gene description: | family with sequence similarity 104, member B |
| Synonyms: | protein FAM104B; CXorf44; family with sequence similarity 104 member B |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaggctgccctgtacggaaaagaagaagaaatggcagtaaagagggcaaccatcattccacccagcccaaaaggaataagagaaaccctatctttcaggattctcaagatacagaggtattttcatggagtgataatgaaaggagcagcagccgcattaatatcccagagagagcaagtggaccagaaggcaacttaaaccagattgttactgaacccgatgcaaactttccccagttcttgcatgagggattgtctaaacctgtttatgtcataaactggtttatgtcctttggtcctgaaataaaactcaatacttcacagcagggaaggaaccaagctgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 107, member B - family with sequence similarity 185, member A - heat shock protein family B (small), member 11 - phosphodiesterase 6D, cGMP-specific, rod, delta |