FAM104B-family with sequence similarity 104, member B Gene View larger

FAM104B-family with sequence similarity 104, member B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM104B-family with sequence similarity 104, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM104B-family with sequence similarity 104, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017571
Product type: DNA & cDNA
Ncbi symbol: FAM104B
Origin species: Human
Product name: FAM104B-family with sequence similarity 104, member B Gene
Size: 2ug
Accessions: BC017571
Gene id: 90736
Gene description: family with sequence similarity 104, member B
Synonyms: protein FAM104B; CXorf44; family with sequence similarity 104 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaggctgccctgtacggaaaagaagaagaaatggcagtaaagagggcaaccatcattccacccagcccaaaaggaataagagaaaccctatctttcaggattctcaagatacagaggtattttcatggagtgataatgaaaggagcagcagccgcattaatatcccagagagagcaagtggaccagaaggcaacttaaaccagattgttactgaacccgatgcaaactttccccagttcttgcatgagggattgtctaaacctgtttatgtcataaactggtttatgtcctttggtcctgaaataaaactcaatacttcacagcagggaaggaaccaagctgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 107, member B
- family with sequence similarity 185, member A
- heat shock protein family B (small), member 11
- phosphodiesterase 6D, cGMP-specific, rod, delta

Buy FAM104B-family with sequence similarity 104, member B Gene now

Add to cart