COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene View larger

COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007723
Product type: DNA & cDNA
Ncbi symbol: COX6A1
Origin species: Human
Product name: COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene
Size: 2ug
Accessions: BC007723
Gene id: 1337
Gene description: cytochrome c oxidase subunit VIa polypeptide 1
Synonyms: CMTRID; COX6A; COX6AL; cytochrome c oxidase subunit 6A1, mitochondrial; COX VIa-L; cytochrome C oxidase subunit VIa homolog; cytochrome c oxidase polypeptide VIa-liver; cytochrome c oxidase subunit VIA-liver; cytochrome c oxidase subunit VIa polypeptide 1; cytochrome c oxidase subunit 6A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtagttggtgtgtcctcggtttctcggctgctgggtcggtcccgcccacagctggggcggcctatgtcgagtggcgcccatggcgaagagggctcagctcgcatgtggaagactctcaccttcttcgtcgcgctccccggggtggcagtcagcatgctgaatgtgtacctgaagtcgcaccacggagagcacgagagacccgagttcatcgcctacccccatctccgcatcaggaccaagccgtttccctggggagatggtaaccatactctattccataaccctcatgtgaatccacttccaactggctacgaagatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDKN2A interacting protein N-terminal like
- family with sequence similarity 104, member B
- family with sequence similarity 107, member B
- family with sequence similarity 185, member A

Buy COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene now

Add to cart