Login to display prices
Login to display prices
COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene View larger

COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene

PTXBC007723

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene

Proteogenix catalog: PTXBC007723
Ncbi symbol: COX6A1
Product name: COX6A1-cytochrome c oxidase subunit VIa polypeptide 1 Gene
Size: 2ug
Accessions: BC007723
Gene id: 1337
Gene description: cytochrome c oxidase subunit VIa polypeptide 1
Synonyms: CMTRID; COX6A; COX6AL; cytochrome c oxidase subunit 6A1, mitochondrial; COX VIa-L; cytochrome C oxidase subunit VIa homolog; cytochrome c oxidase polypeptide VIa-liver; cytochrome c oxidase subunit VIA-liver; cytochrome c oxidase subunit VIa polypeptide 1; cytochrome c oxidase subunit 6A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtagttggtgtgtcctcggtttctcggctgctgggtcggtcccgcccacagctggggcggcctatgtcgagtggcgcccatggcgaagagggctcagctcgcatgtggaagactctcaccttcttcgtcgcgctccccggggtggcagtcagcatgctgaatgtgtacctgaagtcgcaccacggagagcacgagagacccgagttcatcgcctacccccatctccgcatcaggaccaagccgtttccctggggagatggtaaccatactctattccataaccctcatgtgaatccacttccaactggctacgaagatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: