PTXBC015423
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC015423 |
Product type: | DNA & cDNA |
Ncbi symbol: | IFI27L1 |
Origin species: | Human |
Product name: | IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene |
Size: | 2ug |
Accessions: | BC015423 |
Gene id: | 122509 |
Gene description: | interferon, alpha-inducible protein 27-like 1 |
Synonyms: | FAM14B; ISG12C; interferon alpha-inducible protein 27-like protein 1; ISG12(c) protein; family with sequence similarity 14, member B; interferon-stimulated gene 12c protein; interferon alpha inducible protein 27 like 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggaaaggagagtggatgggactcaggcagggctgctgtagcagctgtggtcggaggagttgtggctgtggggactgtgctcgtggcgctcagtgccatgggcttcacctcagtaggaatcgccgcatcctccatagcagccaagatgatgtctacagcagccattgccaacgggggcggagttgctgctggcagtctggtggctattctgcagtcagtgggggcagctggactctctgtgacatctaaagttatcgggggctttgctgggacagctcttggggcctggctgggttcacccccttccagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cytochrome c oxidase subunit VIa polypeptide 1 - CDKN2A interacting protein N-terminal like - family with sequence similarity 104, member B - family with sequence similarity 107, member B |