IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene View larger

IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015423
Product type: DNA & cDNA
Ncbi symbol: IFI27L1
Origin species: Human
Product name: IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene
Size: 2ug
Accessions: BC015423
Gene id: 122509
Gene description: interferon, alpha-inducible protein 27-like 1
Synonyms: FAM14B; ISG12C; interferon alpha-inducible protein 27-like protein 1; ISG12(c) protein; family with sequence similarity 14, member B; interferon-stimulated gene 12c protein; interferon alpha inducible protein 27 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaaggagagtggatgggactcaggcagggctgctgtagcagctgtggtcggaggagttgtggctgtggggactgtgctcgtggcgctcagtgccatgggcttcacctcagtaggaatcgccgcatcctccatagcagccaagatgatgtctacagcagccattgccaacgggggcggagttgctgctggcagtctggtggctattctgcagtcagtgggggcagctggactctctgtgacatctaaagttatcgggggctttgctgggacagctcttggggcctggctgggttcacccccttccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit VIa polypeptide 1
- CDKN2A interacting protein N-terminal like
- family with sequence similarity 104, member B
- family with sequence similarity 107, member B

Buy IFI27L1-interferon, alpha-inducible protein 27-like 1 Gene now

Add to cart